Мр 155 в разобранном виде длина: МР 155, стрельба, затвор и коллиматорный прицел, разборка охотничьего ружья, длина ствола, характеристики и калибр, отзывы

Содержание

со складным прикладом (габариты, вес, размер), годы выпуска, описание и характеристики ⭐ doblest.club

МР-153 — производитель Ижевский завод, ружье с простой конструкцией и невысокой ценой (в среднем, около 25 т.р. по данным сайта GunsBroker.Ru). Подходит для новичков и профессионалов. Чаще всего используется для охоты.

Ружье МР-153

Габариты:

Длина ствола в мм 750
Длина патронника в мм 89
Общая длина (при стволе 750 мм) в мм 1280
Диаметр ствольного канала в мм 18,4
Вес ружья МР-153 в граммах 3450
Вместимость магазина 4+1
Калибр 12

 Описание сфер применения МР-153

Ружье МР-153 универсально, поэтому имеет несколько предназначений:

  • охота — на птицу или живность до среднего размера;
  • стендовая стрельба — ружье должно иметь качественный ствол;
  • самооборона — существует модификация Мр-153, размер которого уменьшен за счет укороченного ствола 510 мм.

 История создания ружья МР-153

Дата

Событие
1998 г. Начало работы над проектом создания универсального ружья
1999 г. Производство первых прототипов и начало испытаний
2000 г. Завершение испытаний и начало массового производства

Задача по разработке нового универсального полуавтоматического ружья была поставлена в 1998 г. До этого Ижевский завод более десяти лет выпускал ружье ИЖ-80, которое имело высокое качество и большой спрос на западе и странах СНГ.

Ружье выпускалось в нескольких модификациях с различной длинной ствола и компоновкой. Новое ружье должно было иметь сходство с ИЖ-80, но включить в себя новейшие научные наработки.

Смотрите также статью Ружье ИЖ-27 и его история

В 1999 году был выпущен первый прототип МР-153.

Характеристики которого удовлетворили разработчиков, и начаты первые испытания, в результате которых было принято решение на полную конструкторскую переработку, после которой продолжались испытания экспериментальных моделей.

В 2000 году была выпущена первое оружие МР-153, характеристики которого позволили приступить к массовому производству. За все годы эксплуатации, полуавтоматическое ружье получило массу положительных отзывов, одним из которых является большая надежность и оптимальные размеры МР-153.

Тактико-технические характеристики МР-153 (ТТХ)

Длина ствола в мм 750 (710, 660, 610)
Длина патронника в мм 89 (76)
МР-153 длина при стволе 750 мм 1280 мм
Диаметр ствольного канала в мм 18,4
МР-153 вес ружья в г 3450 (дерево), 3500 (пластик)
Вместимость магазина 4+1 патрона
Калибр 12
Материал ложи Бук, орех, береза, пластик
МР-153 в разобранном виде

МР-153 — самозарядная автоматическая винтовка с регулируемым поршнем, который находится под стволом. Поршень — коробка с металлической пружиной. Стабильная работа механизма подачи патронов и перезарядки обеспечивается пороховыми газами. Поршень имеет соединение с затворной рамой, что обеспечивает жесткую тягу и затвор ствольного канала качающимся клином.

Смотрите также статью Самозарядное охотничье ружье МЦ 21-12 и его описание

Поршень МР-153

Ствол и патронник ружья имеют хромированное покрытие. Оно обеспечивает защиту от коррозии. Также на стволе есть резьба для установки дополнительных насадок, увеличивающие у ружья МР-153 размеры по длине. Имеется четыре вида модификации стволов — 750, 710, 660, 610 мм.

Удлинитель ствола 300 мм

Ударно-спусковой механизм имеет две степени защиты блокирующие выстрел при незакрытом ствольном канале.

Первая защита — кнопка предохранителя, блокирующая спусковой крючок. Кнопка предохранителя находится в задней части ветви скобы и регулируется в две стороны. Вторая защита — размыкатель ударника, который находиться в личинке затворной рамы.

Ружье МР-153 со складным прикладом

Стандартная ложа МР-153 полупистолетная и выполняется из пластика или дерева. Конструкция ружья позволяет осуществить модернизацию и получить ружье со складным прикладом или пистолетной рукоятью, что значительно уменьшает размер МР-153. Небольшие габариты МР-153 в сложенном состоянии стали комфортными во время транспортировки и хранения оружия.

Патроны

МР-153 использует патроны 12 калибра, которые изготавливаются в странах СНГ и за рубежом. Основные производители:

  • Clever mirage;
  • Рекорд;
  • Искра;
  • Джокер;
  • Сафари;
  • Феттер;
  • Позис;
  • ТехКрим;
  • Скм;
  • Rio;
  • CB;
  • ГлавПатрон.
Патроны 12/70 Clever mirage

Большим спросом пользуются итальянские патроны Clever mirage, которые отлично подходят для охоты и стендовой стрельбы.

Технические характеристики патронов Clever mirage:

Число дробинок в патроне 238
Вес патрона в г 36
Кучность 60-70%
Равномерность осыпи при выстреле до 16 доли
Резкость при выстреле 3 дробинки
Сгущенность по центральной оси 1,54
Коллиматорный прицел с планкой

Для увеличения точности ведения стрельбы с ружья существует возможность установки дополнительных прицелов. Самым распространенным прицелом для МР-153 является коллиматорный прицел, который отлично подходит для охоты и стендовой стрельбы.

Процесс установки прицела:

  • выбить два штифта на корпусе ружья;
  • установить планку Пикатини и закрепить ее винтами;
  • закрепить винтом на планке коллиматорный прицел.

Описание МР-153 по сборке и разборке ружья

Последовательность сборки и разборки оружия прилагается в инструкции, которую производитель МР-153 обязательно вкладывает во все поставки комплектов.

Пошаговый процесс разборки МР-153:

  • открутить гайку магазина;
  • снять цевье;
  • отодвинуть на половину хода затвор, после чего вынуть ствол;
  • снять предохранительный фланец;
  • снять рукоятку заряжания;
  • вынуть подвижную часть затворной рамы, затвор и поршень;
  • снять возвратную пружину и ее упорную часть;
  • снять подавательную пружину и подаватель;
  • выкрутив штифты снять ударно-спусковой механизм.

Модификации МР-153

Remington Spartan 453
Характеристики
Длина ствола в мм
750
Длина патронника в мм 89
Общая длина (при стволе 750 мм) в мм 1280
Диаметр ствольного канала в мм 18,4
Масса в г 3450
Вместимость магазина 4+1
Калибр 12
МР-153С
Характеристики
Длина ствола в мм 510
Длина патронника в мм 76
Общая длина (при стволе 510/750 мм) в мм 1040
Диаметр ствольного канала в мм 18,4
МР-153 вес в г 3200
Вместимость магазина 4+1
Калибр  12
МР-153 для практической стрельбы
Характеристики
Длина ствола в мм 750
Длина патронника в мм
89
Общая длина (при стволе 750 мм) в мм 1280
Диаметр ствольного канала в мм 18,4
Масса в г 3650
Вместимость магазина 9+1
Калибр 12
18,5 КС-П
Характеристики
Длина ствола в мм 750
Длина патронника в мм 89
Общая длина (при стволе 510/750 мм) в мм 1280
Диаметр ствольного канала в мм 18,4
Масса в г 3550
Вместимость магазина 6+1
Калибр 12

Достоинства и недостатки

Ружье МР-153, характеристика которого позволяет признать его отличным универсальным оружием, подойдет для охоты, любительской стрельбы и самообороны.

Ружье имеет простую конструкцию, качественные материалы и отличные характеристики.

Достоинства:

  • простая конструкция;
  • стабильность работы механизмов;
  • разнообразие боеприпасов;
  • высокая скорость стрельбы;
  • возможность установки дополнительных модификаций;
  • защита хромовым покрытием;
  • цена
  • оптимальные размеры ружья МР-153.

Недостатки:

  • сильная отдача;
  • неустойчивость к повышенной влажности.

Какое ружье выбрать начинающему охотнику?


В современных магазинах выбор охотничьего оружия настолько велик, что поневоле глаза начинают разбегаться, особенно у неопытных или начинающих охотников. Но такое богатство выбора может спровоцировать покупку совершенно неподходящего ружья для тех, кто только начинает осваивать это нелегкое дело.  Эта статья создана как раз для тех, кто озадачивается выбором первого ружья для охоты, тут собраны как краткие обзоры наиболее распространенных ружей импортного и отечественного производства, их преимущества и недостатки, так и непосредственные рекомендации по выбору. Выбор оружия для начинающего охотника ограничен только гладкоствольными моделями, так как нарезное оружие можно приобретать только по прошествии пяти лет владения гладкоствольным. 

Двустволка или одностволка

Первый вопрос, которым стандартно задается каждый неофит – именно этот. Какое ружье оптимальнее, удобнее и, разумеется, дешевле. Выбор в этом случае не особо велик – двустволок на отечественном рынке производится всего две – это горизонталка MP (ИЖ)-43 в разных вариантах и вертикалка MP (ИЖ)-27 ( в вертикалке стволы расположены один над другим, в горизонталке, соответственно, на одной горизонтальной линии ).

Одностволка и вовсе выпускается в одном варианте – MP (ИЖ)-18. Многие начинающие охотники склоняются именно в пользу последнего варианта в качестве первого ружья. Аргументы – надежность, неубиваемость и низкая стоимость. Но при этом не берется во внимание те качества, которые необходимы новичку. На этом остановимся подробнее.


Начинающий охотник будет учиться – учиться охотиться и стрелять. И возможность совершить два выстрела, не отнимая ружья от плеча, гораздо удобнее, чем после каждого отвлекаться на перезарядку, а потом заново прицеливаться. Уже один этот момент явно перевешивает в пользу двустволки как первого ружья для начинающего охотника, однако есть и еще один важный момент. В двустволке вы имеете два одинаково готовых к выстрелу патрона разного назначения. Нет, речь сейчас идет не о тех мифических случаях, когда в одном стволе патрон с дробью, а во втором – с пулей на случай внезапной встречи с медведем. На практике охотников, применяющих такой прием, не встречается. Речь тут идет о том, что оба ствола заряжены патронами с дробью разного номера. Вот это как раз повсеместно применяемый вариант.

Применение одноствольного ружья гораздо уже и его выбирают охотники, для которых важен вес, при этом им достаточно одного прицельного выстрела по дичи – чаще всего это сидячая птица или стоячий зверь. Обычно это выбор далеко не начинающих охотников-промысловиков. После того, как выбрана конструкция ружья – все же остановимся на двустволке, как более подходящей для новичка – вектор выбора перемещается на другой момент.

Горизонталка или вертикалка?

Все-таки большинство охотников высказываются в пользу вертикалки, объясняя свой выбор тем, что одним стволом перед глазами манипулировать удобнее. Но это дело привычки, так как новичок не сможет оценить такой незначительный плюс в силу отсутствия опыта. Выбор между горизонталкой и вертикалкой – чистой воды вкусовщина, так как их отличия столь малы, что в конечном итоге не имеют никакого значения. Например, горизонталку удобнее переламывать для перезарядки даже сидя в машине за счет меньшего угла перелома, а вертикалка точнее бьет на дальних расстояниях. Это обусловлено тем, что на расстоянии свыше 100 метров заряды из правого ствола начинают смещаться влево, а из левого – вправо, вертикальное же смещение компенсируется гравитацией. Но такие детали можно заметить только при внушительной дальности выстрела.


Помповые ружья

Основное преимущество помпового оружия – возможность использовать абсолютно любые патроны подходящего калибра. Это здорово работает и на ослабленных, и на усиленных зарядах. Допустимо применение гильз и травматических патронов любой длины, на которые рассчитан патронник, при этом способ перезаряжания остается неизменен – выстрел, цевье назад, вперед – все, ружье снова готово к выстрелу. Забудьте про отказы и недосылы. Именно эта надежность и безотказность объясняет такую популярность данного типа оружия в США, где охотники предпочитают использовать его как при охоте на пернатую дичь, так и при выслеживании опасного и крупного зверя.

Особое внимание хочется уделить пулевым стволам. В России пулевыми называют короткие стволы без дульных сужений, но с выраженными прицельными элементами. Они позволяют вести стрельбу любой калиберной или подкалиберной пулей, но поскольку это все же гладкие стволы, то они годятся и для стрельбы картечью или дробью. Частенько дают хорошие результаты при охоте из-под собаки


Полуавтоматическое оружие

Этот тип ружей отличается внушительным запасом патронов. Пример – знаменитый МР-155 Не нужно совершать никаких дополнительных действий – переламывать, перезаряжать, передергивать цевье, надо просто прицелиться и спустить курок. Закончились патроны – кинул патрон на лоток, нажал кнопку затворной задержки и дослал патроны в подствольный магазин. Такое оружие предпочтительно тогда, когда необходима скорострельность одним типом патронов, например, при массовом отстреле водной дичи.

Подобрать подходящий патронташ

МР-155 Современная модификация выведена в продажу уже со следующими улучшениями:

  • Повышена эргономика цевья – теперь оно более тонкое и легкое

  • Новая конструкция затыльника-амортизатора существенно снижает отдачу

  • Уменьшен ход спускового крючка

  • Увеличены размеры кнопки предохранителя

  • Возможность устанавливать различные прицельные элементы – оптику, коллиматоры

  • Увеличена крышка магазина

Но, как и у любого другого типа оружия, у полуавтоматики есть и свои недостатки. Основной – оно более требовательное к качеству патронов и навеске дроби по сравнению с “переломками” и помпой, а также при стрельбе тратится много патронов. Учиться же лучше с таким ружьем, которое позволяет перевести дух и сделать короткую паузу, тогда как полуавтоматическое оружие пробуждает азарт, результатом которого является бесконтрольная стрельба без учета боеприпасов и небрежное прицеливание. Если брать как основное преимущество именно скорострельность, то с опытом можно достичь примерно такой же скорости стрельбы и на помповике


Мы рассмотрели основные виды охотничьего оружия и хочется добавить еще несколько деталей – одно- и двустволки одинаково хорошо “едят” любые заряды – как заводские, так и самодельные, всеядностью отличаются и помповые ружья, а вот полуавтоматика весьма капризна в этом плане – требовательность к качеству патронов, смазки отличает этот тип оружия.

Не забудьте приобрести средства по уходу за ружьем

Какой калибр ружья выбрать начинающему охотнику

При выборе охотничьего ружья для новичка важно подобрать правильный калибр. Самые ходовые калибры в России следующие:

  • 12 калибр. Его выбирают тогда, когда важна универсальность, так как такое ружье может стрелять и дробью, и картечью, и пулями. Подходит для охоты и на крупную дичь – кабана, медведя, и на мелкую – утку, гуся, зайца. 

  • Оружие 16 калибра легче по весу, обладает меньшей отдачей, подходящий вариант для ходовой охоты. 

  • Ружье 20 калибра часто называют женским из-за слабой отдачи. Предназначено для охоты на мелкую дичь – уток, зайцев. Охотиться на более крупного зверя с таким оружием – сомнительная затея. Например, медведь – крепкий на рану зверь и даже после ранения более крупным калибром может дать охотнику отпор. 


Что надо помнить при выборе охотничьего ружья

Ружье с подствольником или сменным магазином ранее было тяжелее одно- или двустволки, но теперь использование легких сплавов и пластиков в цевье и прикладе практически уравнивает их по весу, а при должном уходе полуавтомат не уступает той же двустволке в надежности. Пример:

МР-155 (полуавтомат) — масса для калибра 12: 3,1-3,2 кг (ствол 710 мм)

ИЖ-27 (двустволка) Вес ружей от 3,1 до 3,65 кг в зависимости от длины ствола и калибра, длина стволов 660-750 мм.

Ружье – это сложный механизм, который при изготовлении требует высокой точности, поэтому отдавайте предпочтение известным брендам, которые успели зарекомендовать себя.

Чехлы для транспортировки оружия

Магазинная одностволка не позволяет изменять кучность стрельбы дробью, однако эта проблема решаема при помощи дульных сужений.

Для изъятия гильз в неавтоматическом оружии используются экстракторы и эжекторы. Они характерны для “переломок”. Первые просто выдвигают гильзы, которые удобно взять руками, а эжектор выбрасывает их резко. Ружье с эжектором более скорострельно, однако помните, что при охоте ночью или на воде гильзы, скорее всего, будут утеряны. 


Тогда как при использовании ружья с экстрактором гильзы можно собрать и переснарядить. Для экстракции гильзы в помповом ружье требуется мускульная сила путём движения цевья на себя и открытия затвора.


Выбираем ружье в магазине

Мы определились, что новичку лучше остановиться на 12 калибре, так как он может использоваться в самых разных условиях. Теперь же продолжаем выбор с учетом следующих параметров:

Осматриваем будущую покупку на наличие дефектов – вмятин, сколов, трещин, зазоров. Помните, что любой зазор – это путь для грязи в сердце механизма, что приводит к поломкам. Верить на слово продавцам не стоит – то, что ружье новое, совершенно не означает его исправность, лучше проверить все самостоятельно.

Важный момент – прикладистость оружия. Это значит, что даже при многочисленных вскидках приклад одинаково ложится на плечо, при этом линия прицела должна совпадать с направлением вашего взгляда с минимальной корректировкой.

Ружье должно подходить вам по весу. Если вы планируете хотя бы изредка бывать на ходовой охоте, то вес не должен быть большим. Тяжелое ружье за спиной в процессе многочасовой ходьбы способно измотать даже профессионала.


Покупаем ружье с рук

Да, и ничего зазорного в этом нет, но необходимо знать нюансы такой покупки. Первое, на что смотрим – на сохранность внутренней поверхности. Для проверки вынимается гильза, а стволы поворачивается по оси каналов. Покачиваем их и смотрим на свет. Если внутри стволов есть небольшая сыпь в виде мелких пятен или потускневшие участки, то это незначительные дефекты, которые не влияют на долговечность ружья и качество боя, а вот если внутри видны следы коррозии, то такой вариант сразу отбраковываем.

Также следует насторожиться, если внешне ружье выглядит потрепанным – потертая ложа, есть прогары вокруг бойков, а внутри стволы идеально гладкие и блестящие. это практически стопроцентная гарантия того, что ружье шустовано. Шустовка – это снятие слоя металла с внутренней поверхности стволов для удаления ржавчины, при этом почти всегда после этого ружье теряет свой бой. Но это касается дорогих импортных моделей, так как процедура весьма дорогая и применять ее на отечественном оружии резона нет никакого.

Проверьте и работу курков, ведь именно они отвечают за скорость выстрела. При взведении должны быть слышны резкие, звонкие щелчки. Проверить силу ударов бойков тоже достаточно просто. Ставим гильзу на боек и спускаем курок. Гильза должна отскочить вверх не менее, чем на полметра.


Основные рекомендации по выбору мы дали, теперь остановимся на конкретике и предоставим небольшой рейтинг охотничьих ружей для новичка, которые подойдут и практикующему охотнику.

МР-27 (ИЖ-27) Простой, надежный спутник охотника. Двуствольная вертикалка, которая производится аж с 70 года со строгим соблюдением технологии. По праву считается народным ружьем – выпущено более 3,5 миллионов штук разных модификаций как с эжектором, так и с экстрактором. Отличный вариант для новичка.

  • ИЖ-27 16 и 12 калибра — основная модель;

  • ИЖ-27-1С — охотничье ружье без эжектора с одним спусковым крючком и последовательной очередностью выстрелов;

  • ИЖ-27Е — ружье с эжектором от Г. Я. Протопопова;

  • ИЖ-27Е-1С — спортивно-охотничья модель с отключаемым эжектором и одним спусковым крючком;

  • ИЖ-27СТ и ИЖ-27 СК — спортивное ружье для стрельбы на траншейном и круговом стенде соответственно с длиной стволов 760 и 660 мм;

  • ИЖ 27М (МР-27М) — ружье без эжектора с двумя спусковыми крючками, имелись вариации ИЖ-27М «Юниор» для женщин и подростков с уменьшенной длиной приклада и ИЖ-27ММ под патрон 12х76 мм «Магнум»;

  • ИЖ-27ЕМ (МР-27ЕМ) — образец с отключаемым эжектором, выбрасывающим только стреляную гильзу, имеет два спуска;

  • ИЖ-27М-1С (МР-27М-1С) — безэжекторная модель с одним спусковым крючком для боя и вторым для настройки последовательности выстрелов;

  • ИЖ-27ЕМ-1С (МР-27ЕМ-1С) — модификация предыдущей модели с отключаемым эжектором селективного типа.

ТОЗ-34Е Не менее знаменитая вертикалка, берущая свое начало в шестидесятых годах и являющаяся основным конкурентом МР-27. Различие этих двух ружей в том, что ТОЗ-34Е в настоящий момент выпускается только под заказ и разбирается на две части, а не на три, как МР-27. Собственно, на этом отличия заканчиваются.

Модификаций у этого ружья тоже достаточно:

Оно имело несколько градаций художественной отделки. В зависимости от исполнения ствольная коробка ружья могла украшаться лазерной, электрохимической или ручной гравировкой, чеканкой, инкрустациями из драгоценных металлов. Варианты исполнения (кроме рядового) обозначались буквой перед номером ружья на ствольной муфте: «У» — улучшенное, «Ш» — штучное, «С» — сувенирное, «П» — подарочное.

  • ТОЗ-34 — базовый вариант (масса 3,15 кг)[1]

  • ТОЗ-34Р — вариант с резиновым затыльником приклада и экстрактором.

  • ТОЗ-34Е — вариант с эжекторным механизмом конструкции Н. И. Коровякова[2], масса 3,2 кг[1].

  • ТОЗ-34ЕР — вариант с эжектором и резиновым затыльником приклада.

  • ТОЗ-34-5,6/20[1] — промысловое комбинированное ружьё с верхним нарезным стволом под патрон .22 LR и нижним под ружейный патрон .20/70 мм (спроектировано в 1980 году, могло комплектоваться оптическим прицелом ПО-2,5х20 или ПО-1[7], выпускалось небольшими партиями).

  • ТОЗ-34-5,6/28[1] — промысловое комбинированное ружьё с верхним нарезным стволом под патрон .22 LR и нижним под ружейный патрон .28/70 мм (спроектировано в 1980 году, могло комплектоваться оптическим прицелом ПО-2,5х20 или ПО-1[7], выпускалось небольшими партиями).

  • ТОЗ-55 «Зубр» — двуствольный штуцер[1].

  • ТОЗ-34-1 — одноствольное ружьё под патрон .12/70 мм, созданное в 1995 году на основе конструкции и с использованием деталей ТОЗ-34[8].

  • ТОЗ-134-20 — двуствольное облегчённое ружьё 20-го калибра с парой вертикально расположенных стволов, разработанное на основе модели ТОЗ-34.

МР-43 (ИЖ-43) Не менее надежная, чем две модели выше, горизонталка. Выпуск налажен тоже в прошлом веке, поначалу была снабжена только экстрактором, но со временем получила множество самых разнообразных модификаций:

  • ИЖ-43 (ИЖ-43М) с двухспусковым механизмом;

  • ИЖ-43Е (ИЖ-43ЕМ) — модификация ИЖ-43 с механизмом автоматического выбрасывания стреляных гильз;

  • ИЖ-43ЕМ-М — модификация ИЖ-43Е с патронниками длиной 76 мм;

  • ИЖ-43-1С — модификация ИЖ-43 с одним спусковым крючком;

  • ИЖ-43Е-1С-М — модификация ИЖ-43-1С с патронниками 76 мм;

  • 12 калибр: 675, 710, 725 и 750. Дульные сужения 0,5 ; 1

  • 12 магнум: 675, 710 и 725. Дульные сужения 0,5 ; 1

  • 16 калибр: 725. Дульные сужения 0,5 ; 1

  • 20 калибр: 675, 710 и 760. Дульные сужения 0,5 (правый), 0,75 (левый).

  • 20 магнум: 675, 710 и 760. Дульные сужения 0,5 (правый), 0,75 (левый).

  • ИЖ-43К двуствольное внутрикурковое ружье с фальшивыми курками

МЦ-21-12 Этот качественный и надежный полуавтомат производят с конца 60 годов, но, несмотря на это, его конструкция настолько совершенна, что в нее практически не вносилось никаких корректировок с того времени. Имеет подствольник на пять патронов и откатную систему перезарядки. При должных навыках это ружье станет верным помощником при любой охоте – как на пернатых, так и на копытных.

МР-81 Производство этого помпового ружья с коротким стволом стартовало в конце 90 годов и предназначалось оно для силовых и охранных структур. Впоследствии же появилась и охотничья модель с длинным стволом. Перезарядка осуществляется путем передергивания цевья с досыланием патрона в ствол. 

Ata Arms Etro Combo 12/76 Турецкое помповое ружье со сменными стволами. По сути, вы приобретаете сразу два ружья – одно с коротким стволом, для развлекательной стрельбы или самообороны, и второе – стандартный охотничий длинноствол со сменными дульными сужениями, ввинчивающимися внутрь.

Турецкие производители сейчас составляют достойную конкуренцию российским оружейным заводам и не уступают по качеству и ресурсу отечественным ружьям – как помповым, так и полуавтоматам. Hatsan Escort полуавтомат тому отличный пример. 

МР-155 Полуавтомат с простой и удобной конструкцией, запчасти для него доступны по цене и есть всегда в наличии. С 2011 года оброс множеством модификаций:

  • МР-155 12х76 в пластике Самая базовая версия. Полимерный обвес упрощает уход. Ружье в этом варианте делается с разными длинами ствола, есть даже модели со сменным пулевым стволом.

  • МР-155 12х76 в камуфлированном пластике. Он не набухает и не портится от влаги, а камуфляжные паттерны скроют оружие от зоркого утиного глаза.

  • МР-155 12х76 в дереве. В качестве материала используются орех, бук и береза, отличаются и внешне, и по стоимости.

  • МР-155 “Профи”. Люксовая версия ружья, отличается особенно тщательной обработкой и подгонкой деталей, ореховым ложем и прикладом, покраской деталей устойчивым покрытием “Cerakote”. Ружье отлично выглядит и не нуждается в доводке.

  • МР-155 12х89 супермагнум. Исполнение с 89 патронником. Уже на заводе газблок отрегулирован для стрельбы навесками свыше 50г, поэтому могут возникать трудности с перезарядкой навесками 24-28г. Что, впрочем, достаточно легко отрегулировать самостоятельно. В остальном, ружья унифицированы с калибром 12х76.

  • МР-155 20х76 Двадцатка существенно легче двенадцатого калибра: 3100 против 3250 грамм. Эта версия подойдет для ходовой охоты, а маленький подброс и увод ствола увеличивает темп и кучность стрельбы. 

Вечная классика МР-18 – одностволка, которую частенько выбирают в качестве первого ружья начинающие охотники. Весит мало, кучность стрельбы хорошая, высокое качество стволов, прикладистость и отличная балансировка – это далеко не все достоинства

  • МР-18М-М – это и есть самая базовая модель. Цена на неё наиболее демократична. Бывает как с постоянным стволом, так и с различными дульными сужениями. Также в комплектацию ружья может входить прицельная планка, наличие которой крайне желательно для начинающих стрелков. Ложа и цевье данного ружья делаются из дерева, как правило, это орех или бук. Данная модификация выпускается в различных калибрах, но к сожалению, в последнее время в охотничьих магазинах встречаются МР-18М-М только в 12 и 16 калибрах;

  • МР-18М-ЕМ – это усовершенствованная модификация, которая имеет эжектор, автоматически выбрасывающий гильзу при открывании ствола. Эжектор имеет функцию отключения, причём это сделать можно даже во время охоты, для чего нужно только повернуть специальный рычаг;

  • МР-18МК-М представляет собой интересный вариант для ценителей старинного одноствольного оружия. Существует небольшой процент охотников, которые считают, что одноствольная переломка должна быть только курковой. Данная модификация будет полностью соответствовать их пониманию идеального однозарядного ружья;

  • Мелкокалиберная модификация МР-18ЕМ-М «Юниор» выпускается специально для обучения стрельбе женщин и детей. Является уменьшенной копией стандартной модификации МР-18М-М. Приклад имеет резиновый затыльник, уменьшающий отдачу при стрельбе;

  • МР-18ЕМ-М «Спортинг» — самая дорогая модификация, предназначенная для спортивной стрельбы. Отличается улучшенным качеством сборки и качеством ствола.

Несмотря на все вышеперечисленные рекомендации по выбору охотничьего ружья для начинающих, главную роль здесь играет желание, личные предпочтения и финансовые возможности. На самом деле ружье может быть любым, так как новичок в охоте должен набить все свои шишки самостоятельно, чтобы понять свои требования к оружию. И уже после этого с полным пониманием всех нюансов приобрести себе то самое идеальное ружье.


Чехлы для всех видов оружия Vektor

Если товар не в наличии, возможно он находится в пути. Если цена вам подходит, вы можете его купить, сделав предзаказ. Менеджер свяжется с вами для уточнения срока доставки.

Даже в наше время, в эпоху высоких технологий и невероятных скоростей, дух настоящего мужчины остается неизменным. Дух охотника, дух воина — добытчика и защитника. Тысячи мужчин по всему миру увлекаются охотой.
Десятки тысяч мужчин служат — в органах охраны правопорядка, в армии, в частных охранных структурах. Нельзя утверждать, что хорошее снаряжение делает из любого человека опытного охотника или воина, но любой настоящий специалист скажет — профессионализм требует качественного современного снаряжения.

Компания Vektor  уже много лет занимается разработкой и производством самого разного снаряжения для охотников, военных и сотрудников силовых структур.

Vektor использует самое современное оборудование и материалы, в его цехах и бюро работают увлеченные и квалифицированные специалисты.

Продукцию Vektor знают и ценят и по всей России, и за ее пределами. Теперь мы предлагаем и Вам оценить ее качество и надежность.

Код товара: 52315-02

Мягкий чехол VEKTOR М-3 для защиты ружья от грязи и влаги непосредственно на месте охоты, длина 120 см., зелёный. Для чехла использована синтетическая ткань без пенополиэтилена, что делает чехо..

Код товара: 624-02

Чехол VEKTOR С-2 из износостойкой, водонепроницаемой ткани, подкладка флок,наполнитель полифом и поролон для полуавтомата, длина 135 см. Чехол из прочного и износоустойчового материала, рекомен..

Код товара: 52316-02

Мягкий чехол VEKTOR М-2 для защиты ружья от грязи и влаги непосредственно на месте охоты, длина 125 см., зелёный. Для оружия с оптикой, ширина 26см. Для чехла использована синтетическая ткань б..

Код товара: 52743-02

VEKTOR К-20 — чехол из капрона с прокладкой из пенополиэтилена для винтовки с оптикой, длина чехла 118 см (ТИГР и аналоги) Чехол из капрона, рекомендован для хранения и транспортировки винтовки..

Код товара: 50808-02

Чехол VEKTOR К-1к из капрона из капрона с поролоном и тканевой подкладкой для винтовки с оптическим прицелом, длина чехла 134. Арт. К-1к. Чехол из капрона, рекомендован для хранения и транспорт. .

Код товара: 51081-02

Чехол из капрона, рекомендован для хранения и транспортировки двуствольного ружья в разобранном виде. Материал использован плотный и износоустойчивый. Чехол содержит поролон и подкладку из смес..

Код товара: 53430-02

Чехол VEKTOR из синтетической ткани с кожаной отделкой, для винтовки с ночным прицелом, длина чехла 128 см. Арт. К-802. Чехол из синтетической ткани, рекомендован для хранения и транспортировки..

Код товара: 53477-02

Мягкий чехол из капрона с поролоном и тканевой подкладкой для двуствольного ружья. Предназначен для переноски и транспортировки охотничего оружия в разобранном виде. Чехол с карманом для сменной па..

Код товара: 52514-02

Чехол VEKTOR из капр. с порол. и ткан. подклад. д/полуавтом. ружья — длина 135см; с карманом под доп.ствол — длина 100см ..

Код товара: 52548-02

VEKTOR Чехол из капрона с прокладкой из пенополиэтилена для МР-153 и аналог., длина 128 см. Чехол из капрона, рекомендован для хранения и транспортировки МР-153 и аналогов. Чехол закрывается на..

Код товара: 52159-02

Чехол ружейный ВЕКТОР К 21 предназначен для хранения и транспортировки винтовки (карабина) общей длиной до 115 см с оптическим прицелом или прочего оружия подходящего по габаритам (высотой не более. .

Код товара: 52331-02

Чехол VEKTOR  k-25 из капрона с прокладкой из пенополиэтилена для винт. с оптикой, 108 см (Соболь, СКС, СУПЕР-ВЕПРЬ и аналог) Характеристики Материал Синтетиче..

Код товара: 52269-02

VEKTOR Чехол из износостойкой, водонепроницаемой ткани, подкладка флок,наполнитель полифом и поролон для полуавтомата, длина 120 см. Чехол из прочного и износоустойчового материала, рекомендова..

Код товара: 52431-02

VEKTOR мягкий чехол из синтетической ткани с кожаной отделкой с поролоном и подкладкой из флока,135 см. Арт. К-901. КОМПАНИЯ «ВЕКТОР» (РОССИЯ). Даже в наше время, в эпоху высоких технол..

Код товара: 53463-

VEKTOR Чехол из капрона с поролоном и тканевой подкладкой для оружия без оптического прицела длина 100 см. Чехол из синтетической ткани, рекомендован для хранения и переноски оружия без прицела. Ма..

Код товара: 52274-02

Этот тактический чехол позволит Вам носить любое оружие как с примкнутым магазином, так и с установленными прицельными приспособлениями. При этом в разложенном положении он может быть использован к..

Код товара: 51485-

Характеристики Vektor A-10: Материал Синтетическая ткань Дополнительный материал Пенополиэтилен . .

Код товара: 52317-02

Мягкий чехол VEKTOR  М-1 для защиты ружья от грязи и влаги непосредственно на месте охоты, длина 135 см., зелёный. КОМПАНИЯ «ВЕКТОР» (РОССИЯ). Даже в наше время, в эпоху высоких технол..

Код товара: 623-02

Чехол из износостойкой, водонепроницаемой ткани, подкладка флок,наполнитель полифом и поролон для винтовки с оптикой, длина чехла 130 см. Арт. С-3. Чехол из прочного и износоустойчового материа..

Код товара: 52677-02

VEKTOR мягкий чехол из синтетической ткани с кожаной отделкой с поролоном и подкладкой из флока для винтовки с оптическим прицелом, 112 см. Чехол из синтетической ткани, рекомендован для хранен..

Код товара: 54626-

Легкий и простой ружейный чехол ВЕКТОР М-2V предназначен для хранения и транспортировки охотничьего оружия в сборе без оптики длиной 125 см, непосредственно на месте охоты защищает его от грязи, ве..

Код товара: 52167-02

VEKTOR Чехол капрон с поролоном для винтовки с оптическим прицелом, длина чехла 118 см, камыш. Чехол из капрона, рекомендован для хранения и транспортировки винтовки с оптическим прицелом. Мате..

Код товара: 54666-

Чехол VEKTOR К-8к капрон с поролоном для п/авт ружья с ночным прицелом, длина 122 см. Оружейный чехол российского производства. Изготовлен из прочного синтетического материала. Применяется для..

Код товара: 52614-02

Чехол  VEKTOR К-86к из капрона с пороллоном, рекомендован для хранения и транспортировки самозарядного ружья 12 кал. в разобранном виде. Материал использован плотный и износоустойчивый. Чехол ..

Код товара: 53088-

Чехол VEKTOR К-85к из капрона с поролоном и тканевой подкладкой для полуавтоматического ружья, длина 128 см. Чехол из синтетической ткани, рекомендован для хранения и транспортировки полуавтом..

Код товара: 52401-

Чехол VEKTOR капрон с поролоном для винтовки с оптическим прицелом, длина чехла 107 см. Легкий и компактный чехол оружейный VEKTOR 107 см для карабина Лось, Вепрь-223, Коршун и схожих..

Код товара: 52406-02

VEKTOR мягкий чехол из синтетической ткани с кожаной отделкой с поролоном и подкладкой из флока для винтовки с оптическим прицелом, 118 см. Чехол из синтетической ткани, рекомендован для хранен..

Код товара: 51083-02

Чехол VEKTOR  из капрона с прокладкой из пенополиэтилена для винтовки с оптическим прицелом, длина чехла 125 мм. Арт. К-2к. Чехол из капрона, рекомендован для хранения и транспортировки ви..

Код товара: 52405-

Чехол VEKTOR К-10к из капрона с прокладкой из пенополиэтилена для двуствольного ружья в разобранном виде с доп. карманом. Чехол из капрона, рекомендован для хранения и транспортировки двустволь..

Код товара: 53476-02

VEKTOR Чехол из синтетической ткани с кожаной отделкой, для самозарядного ружья 12 кл. в разобранном виде. Арт. К-8601. Чехол из синтетической ткани с кожаной отделкой, рекомендован для хранени..

Код товара: 53849-

VEKTOR Чехол из капрона с прокладкой из пенополиэтилена для карабина «Сайга-20-К», «Сайга 410-К-01, 02». Арт. К-120к. Чехол из капрона, рекомендован для хранения и транспортировки карабина «Сай..

Код товара: 52287-

VEKTOR Чехол из капрона с прокладкой из пенополиэтилена для ружей без оптики (полевой), длина чехла 120 см. Арт. К-31. Чехол выполнен из капрона. Рекомендован для хранения и транспортировки руж..

Код товара: 53852-02

Чехол VEKTOR из износостойкой, водонепроницаемой ткани Кордура, подкладка флок,наполнитель полифом и поролон для винтовки с оптикой, длина чехла 127 см. Арт. С-1. Чехол из прочного и износоусто..

Код товара: 52332-02

Чехол VEKTOR K-9k капрон с поролоном для полуавтомата, длина чехла 135 см, камыш Чехол из капрона, рекомендован для хранения и транспортировки полуавтомата. Материал использован плотный и износ..

Код товара: 52925-02

VEKTOR Чехол для винтовки с ночным прицелом длина чехла 118 см. Чехол из синтетической ткани, рекомендован для хранения и переноски винтовки с ночным прицелом в собранном виде. Материал использ..

Код товара: 52191-02

Чехол VEKTOR K-3k капрон для винтовки с оптическим прицелом, 103 см. Чехол из капрона, рекомендован для хранения и транспортировки винтовки с оптическим прицелом. Материал использован плотный и..

Код товара: 52389-02

Чехол VEKTOR K-36 из капрона с прокладкой из пенополиэтилена для винтовки с оптикой, длина чехла 129 см Чехол ружейный предназначен для хранения и транспортировки пневматических винтовок ИЖ-38 ..

Код товара: 52160-02

Чехол VEKTOR  K-34 из капрона с прокладкой из пенополиэтилена для МР-153, МЦ 21-12 в разобранном состоянии. Чехол выполнен из капрона. Рекомендован для хранения и транспортировки МР-153, М..

Код товара: 53090-

Чехол VEKTOR K-22  из капрона с прокладкой из пенополиэтилена для МЦ-21-12 и аналог., длина 135 см, камыш. Арт. К-22 камыш. Чехол выполнен из капрона. Рекомендован для хранения и транспорт..

Код товара: 51486-

Кейс с тремя отстегивающимися карманами и креплением «молле».120*32 ..

Код товара: 53595-02

VEKTOR Чехол капрон с поролоном для винтовки с оптическим прицелом, длина чехла 118 см. Арт. К-5к. Чехол из капрона, рекомендован для хранения и транспортировки винтовки с оптическим прицелом. ..

Код товара: 52327-02

Чехол VEKTOR  из капрона с прокладкой из пенополиэтилена для карабина «Сайга-410К». Чехол из капрона, рекомендован для хранения и транспортировки карабина «Сайга-410К». Материал использова..

Код товара: 52578-02

VEKTOR Чехол из синтетической ткани с кожаной отделкой, для двуствольного ружья в разобранном виде. Чехол из синтетической ткани с кожаной отделкой, рекомендован для хранения и транспортировки ..

Код товара: 53005-02

VEKTOR Ружейный чехол из натуральной кожи для любого двуствольного ружья в разобранном виде с длиной стволов до 760 мм. Чехол выполнен полностью из кожи. Рекомендован для хранения и переноски р..

Код товара: 52451-02

VEKTOR Чехол капрон с поролоном для полуавтомата, длина чехла 138 см. Арт. К-9к. КОМПАНИЯ «ВЕКТОР» (РОССИЯ). Даже в наше время, в эпоху высоких технологий и невероятных скоростей, дух н..

Код товара: 52166-

VEKTOR Чехол из синтетической ткани с кожаной отделкой, с поролоном и подкладкой из флока для двуствольного ружья в разобранном виде. КОМПАНИЯ «ВЕКТОР» (РОССИЯ). Даже в наше время, в эпоху ..

Код товара: 54227-02

VEKTOR Чехол из синтетической ткани с кожаной отделкой, с поролоном и подкладкой из флока для винтовки с оптическим прицелом, длина чехла 130. Арт. К-101. КОМПАНИЯ «ВЕКТОР» (РОССИЯ). Да..

Код товара: 54217-02

VEKTOR Чехол из синтетической ткани с кожаной отделкой, с поролоном и подкладкой из флока для винтовки с оптическим прицелом, длина чехла 123. Арт. К-201. КОМПАНИЯ «ВЕКТОР» (РОССИЯ). Да..

Код товара: 52441-02

VEKTOR Чехол из капрона с прокладкой из пенополиэтилена для карабина «Сайга-20С». Арт. К-119к. КОМПАНИЯ «ВЕКТОР» (РОССИЯ). Даже в наше время, в эпоху высоких технологий и невероятных ск..

Код товара: 52428-02

VEKTOR мягкий чехол из синтетической ткани с кожаной отделкой для винтовки с ночн прицелом, длина чехла 118см. Арт. К-601. КОМПАНИЯ «ВЕКТОР» (РОССИЯ). Даже в наше время, в эпоху высоких..


Купить одну из этих моделей можно нажав на кнопку Купить без перезагрузки страницы. Нажав на фото товара или название модели вы перейдете в карточки товаров.

Набор пластиковых масштабных моделей для самоходных орудий калибра 155 мм 1/72 UM 211 M12 U.S

Набор пластиковых масштабных моделей для самоходных орудий 155 мм 1/72 UM 211 M12 США
  • Home
  • 155-мм самоходная артиллерийская установка в масштабе Пластиковая модель 1/72 UM 211 M12 U.S

UM 211 M12 155-мм самоходная артиллерийская установка США масштабная пластиковая модель 1/72. 155-мм САУ M12 — самоходная артиллерийская установка США времен Второй мировой войны, класс самоходных гаубиц средней по массе.Производитель: UM (Украина). Серийный номер: 211. Масштаб: 1/72 .. Состояние: Новое: Совершенно новый, неиспользованный, неоткрытый, неповрежденный предмет (включая предметы ручной работы). См. Список продавца для получения полной информации. См. Все определения условий : Материал: : Пластик , Характеристики: Комплект isting Перечень комплектов: : Нет N MPN: : 211 : Страна / регион производства: : Украина , Семейство персонажей: Kit Комплект пластиковой модели в масштабе : Масштаб: : 1/72 , Бренд: : UM (UniModels) : Пол: : Мальчики и девочки , Рекомендуемый возрастной диапазон: : 7+ : Описание комплекта: : Пластиковый модельный комплект, неокрашенный, в разобранном виде , Длина модели: : 95 мм / 3.74 дюйма : Покупка включает: : Комплект + бесплатный подарок , UM (UniModels): : Производитель наборов пластиковых масштабных моделей : UPC: : Не применяется ,。







Обновления COVID-19

Помогаем довести Средства к существованию и образ жизни ближе


В Metro Group, мы всегда уделяли приоритетное внимание потребностям, удобству, безопасности и комфорту людей.Делая каждый шаг к этой цели, мы успешно строим наши услуги и бизнес вокруг этого.

Сегодня мы заняли нишу в индустрии недвижимости, управления недвижимостью, строительства и развития инфраструктуры. Metro Group , ориентированная на клиента в первую очередь, признана Пионеры в Одише.

Metro Group построена на основах

Целостность

Доверие

Обязательства

Инновации

За более чем 25 с лишним лет Metro Group выросла семимильными шагами и коснулась многих жизней, создала возможности и принесла Счастье более чем 4000+ семей в Odisha.

Ведущий конгломерат предприятий в основных вертикалях: Недвижимость, Инфраструктура, Розница, Гостиничный бизнес, туры и путешествия, службы безопасности и сельское хозяйство, Metro Group стремится создавать лучшие впечатления во всех сферах жизни.

Помогает вам воплощать ваши мечты в реальность.

Metro Builders, основанная в 1993 году, является одним из самых престижных девелоперов в Одише. Под руководством лидеров отрасли в сфере недвижимости и застройщиков Metro Builders планирует создать новую Odisha с лучшими домами и средствами к существованию.

Узнать больше

Опыт в жилых и коммерческих зданиях

Более 70 успешно завершенных проектов

Строительство свыше 3.5 млн кв. футов площади

Средства к существованию предлагаются более чем 4000 счастливым семьям

Наша недвижимость Портфолио

Метро Гринвудс
Зарегистрировано в ORERA
Rera №: MP / 07/2017/00004

Новое определение дома — это сочетание красоты и функциональности в окружении бескрайней зелени

Узнать больше

метро 100 соток — подъезд
Зарегистрировано в ORERA
Rera №: RP / 19/2018/00016

Создан специально для того, чтобы вы могли выбирать из множества жилых единиц, таких как дуплекс, роскошный дуплекс и триплекс.

Узнать больше

Метро 100 Акров Ананта

Metro 100 Acres Ananta — это первый проект доступного зеленого жилья в рамках IGBC, созданный Odisha.Основными достопримечательностями являются Green Cover на территории, энергоэффективное проектирование зданий.

Узнать больше

метро Удай

Ощутите новый уровень комфорта и роскоши с резиденциями премиум-класса, расположенными в Каттаке.

Узнать больше

Институт Гопабандху Медицинский и исследовательский центр Бхубанешвар

Узнать больше

Инфраструктурные работы Джиндал Нержавеющая сталь, ООО, Бхубанешвар

Узнать больше

Neelachal Ispat Nigam Ltd.
, Бхубанешвар

Узнать больше

155-мм самоходная артиллерийская установка в масштабе пластиковая модель 1/72 UM 211 M12 США

Легко доступен, нет необходимости искать розничных продавцов газонов и садов. Клиенты могут использовать его для приготовления риса. Эта модная и модная шапка станет вашим любимым выбором в качестве аксессуаров.Женский топ с бюстгальтером с высокой поддержкой идеально подходит для тренировок в тренажерном зале, Тейлор проявил предпринимательский дух. 155-мм самоходная артиллерийская установка масштабная пластиковая модель 1/72 UM 211 M12 U.S . Легко наносится и поставляется с простыми инструкциями по применению. ИДЕАЛЬНЫЙ ПОДАРОК: хотите ли вы уникальный подарок для своей жены на годовщину или крутой подарок для своей девушки. Свяжитесь с нами, чтобы узнать, какой размер вам нужен. Лицевая сторона кармана представляет собой многоцветный цветочный акцент с полосой из ржавых и золотых точек и темно-коричневыми деревянными пуговицами, а галстук / пояс — булавка из темного шоколада, набор шашек для бутылок в стиле Fallout. . 155-мм самоходная артиллерийская установка масштабная пластиковая модель 1/72 UM 211 M12 U.S . Он в отличном состоянии, без слез, — [Цвет браслета] с коробкой: включает карту браслета 3 «x3». Они идеально подходят для любой романтичной женщины, которая ищет что-то уникальное для своей обуви. Для чего-то более современного попробуйте напечатать на пергаменте. Не смотрите номер своей модели в приведенном выше списке. 155-мм самоходная артиллерийская установка масштабная пластиковая модель 1/72 UM 211 M12 U.S . Эти индивидуально подогнанные коврики роскошны и долговечны. Он состоит из металлических пластин, смешанных с пластиковым материалом, чтобы не сломаться (см. Изображение в разрезе X ниже)
5, Датчик высоты для автоматического зависания.День матери или особый случай, рулонная клейкая магнитная лента размером 1 дюйм X 100 футов — Magnum Magnetics: товары для офиса. Набор пластиковых моделей в масштабе 155-мм самоходного орудия 1/72 UM 211 M12 США .

Метто Супермаркет ЦДА Сектор-9

Metto Super Market — универсальное решение для самообслуживания, предлагающее широкий ассортимент кухонных и бытовых товаров.

Узнать больше

Метто Супермаркет Satichoura chakk, Cuttack

Metto Super Market — универсальное решение для самообслуживания, предлагающее широкий ассортимент кухонных и бытовых товаров.

Узнать больше

Президентский отель

Просторный, светлый и со всеми удобствами, чтобы сделать ваше пребывание уникальным и незабываемым.

Узнать больше

Голубая лагуна Премиум

Мы — один из самых доступных отелей в Каттаке, который предлагает современные удобства для ценных клиентов.

Узнать больше

Metro Palms International

Metro Palms International имеет уникальный линейный фасад, напоминающий линию, уходящую в небо.

Узнать больше

Президентский курорт

У нас есть линия установления рекордов, поскольку у нас есть самый большой банкетный зал без колонн в Индии, занесенный в Книгу рекордов Индии.

Узнать больше

Метро Гринвудс

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Изумруд

Несколько описаний проектов.Одна или две строки

Узнать больше

Metro Palms International

Несколько описаний проектов. Одна или две строки

Узнать больше

Метро Гринфилд

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Гринвудс

Несколько описаний проектов.Одна или две строки

Узнать больше

Metro Palms International

Несколько описаний проектов. Одна или две строки

Узнать больше

Метро Изумруд

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Гринфилд

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Гринвудс

Несколько описаний проектов. Одна или две строки

Узнать больше

Метро Изумруд

Несколько описаний проектов.Одна или две строки

Узнать больше

Metro Palms International

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Гринфилд

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Гринвудс

Несколько описаний проектов. Одна или две строки

Узнать больше

Metro Palms International

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Изумруд

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Гринфилд

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Гринвудс проект

Несколько описаний проектов. Одна или две строки

Узнать больше

Metro Palms International

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Изумруд

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Гринфилд

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Гринвудс

Несколько описаний проектов. Одна или две строки

Узнать больше

Metro Palms International

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Изумруд

Несколько описаний проектов.Одна или две строки

Узнать больше

Метро Гринфилд

Несколько описаний проектов.Одна или две строки

Узнать больше

Отзывы

Я никогда не думал о покупке квартиры в таком раннем возрасте и, тем более, когда не принимал решение о таких инвестициях, по крайней мере, еще на 2 года. Я просто зашел на сайт и узнал о зеленых лесах, потом руководитель отдела продаж метро связался со мной по телефону и попросил о встрече, но опять же мне было совершенно не интересно нанести визит. я к нему на встречу. Огромное спасибо Metro Group за то, что помогли получить мою первую квартиру. Я доволен тем, как все прошло гладко, как сотрудники метрополитена помогли мне со всеми бумагами и четкими разъяснениями по моим вопросам.Большое спасибо всей команде метро. Я бы порекомендовал людям посещать проекты метро и быстрее получить дом своей мечты.

Манодж Кумар Махарана


Морской инженер

Иметь дом — всегда мечта обычного человека.Метро 100 акров дало мне прекрасную возможность владеть им. Когда менеджер по продажам привел меня и мою жену в это место, для нас обоих это было похоже на «любовь с первого взгляда». После обсуждения с г-ном Хаком и Софией Мадам я, наконец, забронировал номер 4 февраля 2019 года. С тех пор мне помогает команда Metro, и отношения продолжаются ……..

Г-жа Мадхумита и г-н Сибанджан


Метро 100 акров

Я гордый владелец дуплекса в метро 100 акров — «Доступ».Мой опыт покупок в METRO GROUP был на высоте. Во-первых, ваш менеджер по продажам дал краткое и ясное представление о принятии лучших решений по выбору дуплекса. Во-вторых, было легко добраться до торговой марки и прошлых лет организации и принять решение о покупке. Профессиональные и дружеские отношения сделали эту сделку удачной. Службы почтовых продаж, предоставленные командой CRM, были фантастическими. По той же причине я лично рекомендовал многих своих коллег и друзей для участия в конкретном проекте.
Взгляд в будущее, чтобы в будущем испытать тот же уровень опыта.

Амар Дас


Метро 100 Акров

Это незабываемый опыт работы с Metro Group с первого дня. Я купил участок № 29 в группе метро. Все члены группы метро хорошо рассказали о своем проекте, и когда я встречусь с командой CRM, они всегда оказывают мне хорошее гостеприимство, и они всегда готовы помочь в этом вопросе с недвижимостью и всякий раз, когда я любые вопросы они объясняют.Будучи клиентом, я прежде всего благодарю всех участников за их прекрасную работу до сих пор, и, наконец, я бы сказал, что до сих пор у меня был замечательный опыт работы с метро, ​​и надеюсь, что такие же виды усилий будут и в будущем.

Нихарика Йена


На самом деле я очень рад поделиться своим опытом, так как недавно совершил покупку в группе метро.Метрополитен очень хорошо помогает своим клиентам. Я ценю их постоянную доступность для нас, отвечая на наши запросы в любое время, для предоставления качественных домов. Они создают доверие клиентов, делясь каждой деталью.
Я очень благодарен руководителю отдела продаж, который приложил огромные усилия для строительства дома нашей мечты.
Спасибо группе метро, ​​которая помогла нам осуществить наши мечты ..

Джошна


Это был хороший опыт общения с вами и Metro Group во время продажи и обслуживания.Информация перед продажей была очень честной и конкретной. После продажи тоже хорошее впечатление. Группа понимает клиента и уделяет достаточно времени, когда это необходимо. Большое спасибо и с нетерпением жду лучших услуг.

Мадхусмита Саху и Пратап Саху


CII-IGBC открывает отделение в Бхубанешваре с нашим директором в качестве сопредседателя.

Credai National Womans Wing 2019 Церемония установки 2019-2022 в Пуне.

Доставка эмоциональных домов покупателям — Metro Group на Самбаде.

Metro Greenwoods — самый доступный жилой проект 2017 года.

Metro Team на Times Business Awards 2020.

Награда за лидерство в бренде Odisha 2020.

Спасибо, что поверили в нас.

155-мм самоходная артиллерийская установка в масштабе пластиковая модель 1/72 UM 211 M12 U.S

Алюминиевый руль Wheely

Integy для трактора Traxxas 1/10 Stampede 4X4. 8,5-дюймовая резиновая площадка с четырьмя квадратными шариками, 6 шт., С ручным насосом. Угадай фальшивую игру, необычную / обычную массовую игру на свету / исключение-NM Pokemon 500 Rares / Holos / Vintage. LEGO # 8831 — Коллекционер серии # 7 «HIPPIE», RW Торговый автомат Shopkins Жесть для хранения. Набор для переоборудования GUN Fumi Alloy Servo Saver для Kyosho Optima 2016-29008.Ремни безопасности T28B / D Trojan для Kitty Hawk Painted eduard 32877 1/32 Aircraft. 1:24 Россия СССР СССР Горький Газ-М20 Победа Газ М20 Волга литая модель автомобиля-игрушки. Боевой гимн * PLAYSET * Magic MtG x4 Avacyn Restored SP. Фигурка Funko Five Nights at Freddy’s-Sister Location Funtime Freddy 13741.

Узнать больше

С

1993

Мы создание средств к существованию и добавляя больше улыбок для более 4000+ семей в Одиша.

Одиша, благословенная земля культуры, разнообразия и роста.

Штат значительно вырос и будет продолжать делать это во всех основных областях туризма, технологий и недвижимости. Хорошо спланированный штат Одиша является наиболее многообещающим вариантом для инвестиций, который известен простотой ведения бизнеса и обеспечивает соответствующие условия для жизни и роста.

Узнать больше ->

155-мм самоходная артиллерийская установка в масштабе пластиковая модель 1/72 UM 211 M12 U.S


Масштаб: 1/72, 155-мм САУ M12 — самоходная артиллерийская установка США времен Великой Отечественной войны, класс самоходных гаубиц, средних по массе, Производитель: UM (Украина), Серийный номер: 211, быстрая БЕСПЛАТНАЯ доставка Самый модный дизайн — идеальное место для покупок в Интернете.

Canfam_GSD: De novo сборка генома по длине хромосомы немецкой овчарки (Canis lupus familis) с использованием комбинации длинных считываний, оптического картирования и Hi-C | GigaScience

Аннотация

Общие сведения

Немецкая овчарка (GSD) — одна из самых распространенных пород на Земле, выведенная за ее полезность и интеллект.Часто это первый выбор для работы в полиции и в армии, а также для защиты, помощи инвалидам и поисково-спасательных служб. Тем не менее, как известно, GSD подвержены целому ряду генетических заболеваний, которые могут мешать их тренировкам. Такие заболевания вызывают особую озабоченность, когда они возникают в более позднем возрасте, и полностью обученные животные не могут продолжать свои обязанности.

Результаты

Здесь мы предоставляем черновой вариант последовательности генома здоровой самки немецкой овчарки в качестве ориентира для будущих исследований болезней и эволюции.Мы создали этот улучшенный эталонный геном собак (CanFam_GSD), используя сочетание технологий Pacific Bioscience, Oxford Nanopore, 10X Genomics, Bionano и Hi-C. Сборка GSD примерно в 80 раз более смежна, чем текущий эталонный геном псовых (20,9 против 0,267 Мб контига N50), содержит гораздо меньше пропусков (306 против 23 876) и меньшее количество каркасов (429 против 3310), чем текущий эталонный геном псовых CanFamv3.1 . Две хромосомы (4 и 35) собраны в единый каркас без разрывов. BUSCO анализ результатов сборки генома показывает, что 93.0% консервативных однокопийных генов завершены в сборке GSD по сравнению с 92,2% для CanFam v3.1. Аннотации генов на основе гомологии увеличивают это значение до ∼99%. Детальное изучение эволюционно важной области амилазы поджелудочной железы показывает, что существует, скорее всего, 7 копий гена, что указывает на дупликацию 4 предковых копий и нарушение 1 копии.

Выводы

Сборка и аннотация генома GSD были получены с существенным улучшением полноты, непрерывности и качества по сравнению с существующими референсами псовых.Этот ресурс позволит проводить дальнейшие исследования, связанные с болезнями собак, эволюционными взаимоотношениями собак и другими аспектами биологии собак.

Введение

Произошедшая от диких серых волков на Евразийском континенте> 15 000 лет назад, собака ( Canis lupus familis , NCBI: txid9615) была первым видом, который был приручен [1–3]. Данные митохондриальной ДНК предполагают, что очагами приручения собак могли быть Китай [3], Европа [4] и Ближний Восток [5]. С момента одомашнивания собачьи прошли тысячи лет селекционного разведения, в результате чего появилось множество фенотипических вариантов. Однако возраст большинства современных пород составляет менее 200 лет, и они имеют европейское происхождение [6, 7].

Немецкая овчарка (GSD) — это рабочая собака среднего и крупного размера, выведенная из обычных домашних собак в конце XIX века в континентальной Европе [7]. В 1899 году капитан Макс фон Штефаниц посетил выставку собак, и ему была показана собака по кличке «Гектор Линксрайн».«Гектор удовлетворился тем, чем, по мнению фон Штефаница, должна быть рабочая собака, и он сразу же купил его. После покупки собаки фон Штефаниц изменил свое имя на« Хоранд фон Графрат »и основал Verein für Deutsche Schäferhunde (Общество немецких овчарок) . Хоранд был объявлен первой немецкой овчаркой и первой собакой, внесенной в реестр пород общества [8]. Сообщается, что фон Стефаниц сохранял сильное господство над ранним развитием немецкой овчарки, и это, вероятно, привело к некоторой степени инбридинг.Однако это также позволило закрепить качества, которые теперь являются особенностями породы.

Последующие роли GSD, которые включали охрану и работу полиции, способствовали селективному разведению более крупных и уверенных в себе собак [9]. За последние десятилетия дальнейший отбор в сторону характеристик, считающихся желательными для выставочного ринга, еще больше изменил конформацию GSD [10]. Возможно, самым известным заболеванием является дисплазия тазобедренного сустава собак (ИБС), которая представляет собой сложное заболевание, сочетающее в себе генетические факторы и факторы окружающей среды.Генетические факторы, такие как неглубокая вертлужная впадина, подвывих и плохо формирующиеся головки бедренной кости, в тяжелых случаях проявятся в раннем возрасте собаки. Факторы окружающей среды, такие как избыточный вес или плохое место для упражнений (много лестниц и много прыжков в подростковом возрасте), проявятся в более позднем возрасте. Другие распространенные проблемы со здоровьем включают дисплазию локтя, вздутие живота, дегенеративную миелопатию, эпилепсию, гемофилию, диабет, воспалительное заболевание кишечника и различные виды рака, включая остеосаркому, лимфому и меланому [11–16].

Известно, что в Австралию ранний импорт GSD начался с 1904 года. В октябре 1928 года федеральное правительство Австралии наложило запрет на импорт породы, который вступил в силу в 1929 году. чтобы растянуться еще на 43 года, в страну было ввезено немного импортных товаров. Запрет на импорт был снят в 1972 году, а некоторые ограничения оставались до 1976 года. После снятия запрета на импорт в Австралию были импортированы немецкие, новозеландские, английские и некоторые американские собаки, и порода стала популярной.В настоящее время GSD является крупнейшей породой (чистокровной) популяцией собак в Австралии [17].

Целью этого исследования является предоставление с высоким разрешением долго считываемой сборки de novo генома самки GSD, свободной от известных генетических заболеваний (рис. 1). Эта сборка генома de novo станет бесценным инструментом для углубления знаний как о простых, так и о полигенных генетических заболеваниях, а также об эволюционном сродстве GSD.

Рисунок 1:

«Нала», сука немецкой овчарки.Нала, или формально «Йонкахра Нала» (регистрационный номер в Австралии 2100398550), родилась в 2013 году и не страдает всеми известными генетическими заболеваниями. Ее отец был импортирован из Германии, а мать — из Австралии.

Рисунок 1:

«Нала», сука немецкой овчарки. Нала, или формально «Йонкахра Нала» (регистрационный номер в Австралии 2100398550), родилась в 2013 году и не страдает всеми известными генетическими заболеваниями. Ее отец был импортирован из Германии, а мать — из Австралии.

Результаты

Рабочий процесс

Геном был собран с использованием секвенирования одиночной молекулы в реальном времени (SMRT) Pacific Bioscience (PacBio), секвенирования Oxford Nanopore (ONT) PromethION, 10X Genomics Chromium секвенирования генома с помощью Bionano и каркаса Hi-C (дополнительный рис. 1). Контиги были собраны с использованием SMRT и ONT секвенирования [18], а затем отполированы [19, 20], чтобы минимизировать распространение ошибок (подробности см. В разделе «Сборка генома длительного чтения»). Контиги собранных последовательностей были последовательно скомпонованы с использованием 10X связанных считываний, оптического картирования Bionano и лигирования Hi-C-близости. Чтобы увеличить непрерывность сборки, мы использовали чтения SMRT и ONT для заполнения пробелов, после чего был проведен последний этап полировки. Прогнозирование генов на основе гомологии было выполнено с использованием C.lupus knownis и 8 родственных млекопитающих. Полученная в результате сборка генома по длине хромосомы и аннотация к нему гена были депонированы в NCBI с номером доступа GCA 008641055.2. Впоследствии к сборке был добавлен митохондриальный геном (VSDE01000430). Наконец, были проведены сравнения с собачьим геномом боксера (CanFam3.1) [21].

Статистика сборки / комплектность

Окончательная заявка содержит 2,407,291,559 общих п.н. (2,401,147,102 незащищенных), 429 каркасов с длиной контига N50, равной 20.9 Мб, а леска N50 длиной 64,3 Мб. Полноразмерные каркасы хромосом в сборе составляют 98,3% генома, при этом только 0,95% всей последовательности не выравнивается с хромосомой CanFam3.1. Оценка BUSCO (BUSCO v3.0.2b [22], короткий режим, реализация BLAST + v2.2.31 [23], HMMer v3.2.1 [24], AUGUSTUS v3.3.2 [25] и EMBOSS v6.6.0) против Laurasiatheria_ob9 набор данных (n = 6253) показал, что 93,0% консервативных генов с одной копией были полными (таблица 1, дополнительные таблицы 1, 2, дополнительный рис.2). Каждый этап анализа при сборке, возведении строительных лесов и полировке улучшал баллы каркаса N50 и / или BUSCO, что соответствовало повышению качества сборки (дополнительная таблица 1, дополнительный рисунок 2). Прогнозы BUSCO чувствительны к изменениям в последовательности и размере сборки, при этом строительные леса и полировка вызывают как потери, так и прибыль (дополнительная таблица 1). Компиляция результатов BUSCO на всех этапах сборки (BUSCOMP v0.8.0) показывает, что ≥6085 (97,3%) присутствуют и завершены в сборке, только 118 генов (1.9%) не обнаружено ни на одном этапе.

Таблица 1: Статистика сборки и аннотаций генома

для сборки GSD в сравнении с CanFam3.1

Статистика . GSD . CanFam3.1 .
Общая длина последовательности 2,407,291,559 2,410,976,875
Общая длина без зазоров 2,401,147,102 2,392,715,236 № 9045контигов 735 27,106
Contig N50 20,914,347 267,478
Contig L50 37 2,436 904 904 Строительные леса N50 64,346,267 63,241,923
Строительные леса L50 15 15
Кол-во зазоров 306 ген.0% (91,6% одиночная копия, 1,4% дубликат) 92,2% (91,1% одиночная копия, 1,1% дубликат)
BUSCO фрагментированный (геном) 3,6% 4,0%
BUSCO отсутствует (геном) 3,4% 3,8%
BUSCO завершено (аннотация) 98,9% (96,5% единственная копия, 2,4% двойная копия) 95,1% (94,1% одиночная копия, 1,0% двойная копия )
BUSCO фрагментированный (аннотация) 1.0% 1,9%
BUSCO отсутствует (аннотация) 0,1% 3,0%
Статистика . GSD . CanFam3.1 .
Общая длина последовательности 2,407,291,559 2,410,976,875
Общая длина без зазоров 2,401,147,102 2,392,715,236 № 9045контигов 735 27,106
Contig N50 20,914,347 267,478
Contig L50 37 2,436 904 904 Строительные леса N50 64,346,267 63,241,923
Строительные леса L50 15 15
Кол-во зазоров 306 ген. 0% (91,6% одиночная копия, 1,4% дубликат) 92,2% (91,1% одиночная копия, 1,1% дубликат)
BUSCO фрагментированный (геном) 3,6% 4,0%
BUSCO отсутствует (геном) 3,4% 3,8%
BUSCO завершено (аннотация) 98,9% (96,5% единственная копия, 2,4% двойная копия) 95,1% (94,1% одиночная копия, 1,0% двойная копия )
BUSCO фрагментированный (аннотация) 1.0% 1,9%
BUSCO отсутствует (аннотация) 0,1% 3,0%
Таблица 1:

Статистика сборки и аннотаций генома для сборки GSD по сравнению с CanFam3.1

Статистика . GSD . CanFam3.1 .
Общая длина последовательности 2,407,291,559 2,410,976,875
Общая длина без зазоров 2,401,147,102 2,392,715,236 № 9045контигов 735 27,106
Contig N50 20,914,347 267,478
Contig L50 37 2,436 904 904 Строительные леса N50 64,346,267 63,241,923
Строительные леса L50 15 15
Кол-во зазоров 306 ген.0% (91,6% одиночная копия, 1,4% дубликат) 92,2% (91,1% одиночная копия, 1,1% дубликат)
BUSCO фрагментированный (геном) 3,6% 4,0%
BUSCO отсутствует (геном) 3,4% 3,8%
BUSCO завершено (аннотация) 98,9% (96,5% единственная копия, 2,4% двойная копия) 95,1% (94,1% одиночная копия, 1,0% двойная копия )
BUSCO фрагментированный (аннотация) 1. 0% 1,9%
BUSCO отсутствует (аннотация) 0,1% 3,0%
Статистика . GSD . CanFam3.1 .
Общая длина последовательности 2,407,291,559 2,410,976,875
Общая длина без зазоров 2,401,147,102 2,392,715,236 № 9045контигов 735 27,106
Contig N50 20,914,347 267,478
Contig L50 37 2,436 904 904 Строительные леса N50 64,346,267 63,241,923
Строительные леса L50 15 15
Кол-во зазоров 306 ген.0% (91,6% одиночная копия, 1,4% дубликат) 92,2% (91,1% одиночная копия, 1,1% дубликат)
BUSCO фрагментированный (геном) 3,6% 4,0%
BUSCO отсутствует (геном) 3,4% 3,8%
BUSCO завершено (аннотация) 98,9% (96,5% единственная копия, 2,4% двойная копия) 95,1% (94,1% одиночная копия, 1,0% двойная копия )
BUSCO фрагментированный (аннотация) 1.0% 1,9%
BUSCO отсутствует (аннотация) 0,1% 3,0%

Дополнительный анализ конечной сборки на k -мер был выполнен с использованием KAT v2.4.2 [26]. KAT comp использовался для сравнения частот k -меров из 10-кратных считываний (штрих-код 16 п.н., обрезанных из считывания 1) с их количеством копий в сборке. Это сравнение не выявило признаков отсутствия данных или больших дупликаций, включая сохранение гаплотигов (дополнительный рис.3).

Сравнение с CanFam3.

1

Сборка GSD сравнивалась с текущим эталонным геномом CanFam3.1. Результаты приведены в Таблице 1.

Сборка GSD предлагает улучшения по сравнению с CanFam3.1 с использованием широкого набора показателей. Сборка GSD имеет контиг N50, который почти в 80 раз больше, чем CanFam3.1, и содержит в 78 раз меньше зазоров и на 2881 меньше каркасов. Результаты BUSCO по геному также указывают на улучшение сборки GSD с 47 более полными генами (на 25 меньше фрагментированных генов и на 22 меньше отсутствующих генов).

На основе существующей аннотации CanFam3.1 и аннотации GSD, предоставленной GeMoMa [27], был выбран самый длинный полноразмерный транскрипт для каждого гена, чтобы избежать переоценки дублированных генов с помощью BUSCO v3.02. Сравнивая статистику BUSCO для аннотаций, можно было наблюдать явное улучшение с 95,1% до 98,9% полных ортологов с одной копией.

Вариация относительно CanFam3.1

Все 39 полноразмерных хромосом в окончательной сборке были выровнены с соответствующими хромосомами в CanFam3.1 с использованием MUMmer4 [28]. Однонуклеотидные полиморфизмы (SNP) и небольшие инделки (делеции и вставки <50 п.н.) вызывались с использованием модуля MUMmer4 call-SNPs. Всего было обнаружено 3 137 227 SNV и 5 111 356 мелких инделей (дополнительная таблица 3). Варианты числа копий (CNV) и структурные варианты (SV) вызывались с помощью svmu (v0.2) [29]. Были извлечены варианты> 100 п.н., что дало всего 66 673 CNV / SV. По типу варианта это было разбито на 39 742 CNV, 13 552 вставки, 13 150 делеций и 229 инверсий (дополнительная таблица 4).

Анализ панкреатической амилазы (AMY2B)

AMY2B играет важную роль в эволюции псовых, при этом изменение количества копий связано с адаптацией крахмальной диеты у древних европейских собак. Ollivier et al. изучили как древних, так и современных собак, обнаружив расширение уже в седьмом веке, когда у современных собак было от 4 до 16 копий [30]. Не было обнаружено ни одного длительного чтения, охватывающего весь регион. Самое длинное чтение в регионе охватывало ≤3 полных копий, при этом 4 копии в конечном итоге были отправлены в сборку GSD.Дальнейшее изучение этой области было предпринято с использованием как оптической карты Bionano, так и анализа глубины считывания из считываний SMRT и ONT (дополнительный файл 1). Результаты глубины чтения показывают, что существует от 7 до 8 копий гена, в то время как карта Bionano показала, что наиболее вероятное число копий равно 7 (рис. 2). Для анализа Bionano отдельные молекулы данных Bionano были de novo , собранные с использованием алгоритма, учитывающего гаплотипы (дополнительный файл 2), для получения поэтапного согласованного набора карт генома.Сопоставление полученных геномных карт со сборкой GSD выявило 2 гомозиготных аллеля (ID карты 1111 и 1112), охватывающих область AMY2B , как предсказано GeMoMa (дополнительный рис. 4). Выравнивание показывает «вставку» размером ~ 11 т.п.н., фланкированную ферментными метками DLE1 в положениях 47,325,815 и 47,333,432 NALACHR6.01, что позволяет предположить, что этот фрагмент, расположенный выше области AMY2B , либо потерян, либо разрушен в сборке GSD . Кроме того, область между метками DLE1 на 47 341 704 и 47 396 280, которая включает 3 из предсказанных GeMoMa копий AMY2B , тандемно дублируется, что предполагает 7 возможных копий AMY2B в Nala.Эти 2 аллеля поддерживаются в среднем 40 и 23 одиночными длинными молекулами, 12 из которых охватывают структуру полного повтора, из которых 8 также охватывают вставку размером 11 т.п.н. Здесь следует отметить, что из-за сходства последовательностей между 4 предсказанными GeMoMa копиями AMY2B и связанных с ними присущих неоднозначностей выравнивания неясно, какие именно повторяющиеся единицы дублируются.

Рисунок 2:

Аллели генома Bionano сопоставлены с гипотетическими конструкциями последовательностей.Гипотетические конструкции последовательности (зеленые столбцы) содержат либо 7 (помеченных «amy2b_dom7copyext»), либо 8 (помеченных «amy2b_dom8copyext») копий повторяющейся единицы (выделены цветными рамками в зеленой полосе и пронумерованы белым шрифтом). Темно-синие и желтые вертикальные линии на контигах последовательностей и консенсусной карте указывают на совпадающие и несовпадающие ферментативные метки DLE1, соответственно.

Рисунок 2:

Аллели генома Bionano сопоставлены с гипотетическими конструкциями последовательностей. Гипотетические конструкции последовательности (зеленые столбцы) содержат либо 7 (помеченных «amy2b_dom7copyext»), либо 8 (помеченных «amy2b_dom8copyext») копий повторяющейся единицы (выделены цветными рамками в зеленой полосе и пронумерованы белым шрифтом).Темно-синие и желтые вертикальные линии на контигах последовательностей и консенсусной карте указывают на совпадающие и несовпадающие ферментативные метки DLE1, соответственно.

По сравнению с CanFam3.1 пара аллелей гомозиготной карты генома показывает вставку размером ~ 100 т.п.н., фланкированную метками DLE1 в положениях 464 и 46999962 Chr6 (дополнительный рисунок 5), что указывает на полную потерю Локус AMY2B в CanFam3.1.

Чтобы лучше определить, поддерживают ли данные Bionano 7 или 8 копий повтора AMY2B , мы сравнили 2 аллеля карты генома с 2 конструкциями синтетической последовательности, содержащими либо 7 (amy2b_dom7copyext), либо 8 (amy2b_dom8copyext) копий 14,862-п.н. AMY2B повторяется с поддержкой максимальной глубины чтения (а именно, третья копия) из сборки GSD, окруженная ∼401.Последовательности размером 5 т.п.н., собранные из считываний SMRT и ONT (дополнительный файл 1). Результаты сопоставления подтвердили наличие 7 повторяющихся единиц, что показывает полное совмещение с конструкцией с 7 копиями (фиг. 2A), но «удаление» 1 повторяющейся единицы по сравнению с конструкцией с 8 копиями (фиг. 2B).

Анализ обонятельных рецепторов и кластеров кератина

Правильная аннотация обонятельных и кератиновых кластеров у собак была проблематичной, но это важно для исследований здоровья и эволюции собак [21, 31, 32]. Собаки — животные-макросматики, которые во многом полагаются на свое обоняние. Тем не менее, молекулярная основа такой выдающейся хемосенсорной способности остается в значительной степени неизвестной. Способность обнаруживать и различать множество запахов у позвоночных обеспечивается суперсемейством белков обонятельных рецепторов (OR), связанных с G-белками [33]. Основываясь на описании в аннотациях к ссылкам, мы отфильтровали все информационные РНК (мРНК) ссылок, которые содержат в своем описании регулярное выражение «обонятельный рецептор.Затем мы извлекли количество мРНК и генов на эталонный организм. Впоследствии мы использовали идентификаторы для фильтрации аннотации GSD и подсчитали количество предсказанных мРНК и генов. Эта процедура определяет 1250 мРНК и 933 гена в GSD и 849 мРНК и 804 гена в боксере. Quignon et al. [31] идентифицировали 5 аминокислотных паттернов, характерных для OR в геноме собак, и извлекли 1094 гена собак (872 гена и 222 псевдогена).

Кератины представляют собой белки волокон эпителиального цитоскелета и необходимы для нормального гомеостаза кожи.Со временем гены, кодирующие кератины, претерпели несколько раундов дупликации с высоким сходством между различными паралогами кератина [32]. Аналогично исследованию обонятельных рецепторов мы отфильтровали все мРНК ссылок, содержащих в своем описании ключевое слово «кератин \ d». Эта процедура идентифицирует 118 мРНК и 83 гена в GSD и 73 мРНК и 55 генов в боксере. Balmer et al. [32] исследовали предсказания гена NCBI (dog annotation release 103) для кластеров собачьих генов по данным секвенирования РНК, которые были получены из взрослой кожи 5 собак и ткани волосяного фолликула взрослого 1 собаки, и аннотировали 61 предположительно функциональный ген кератина собака.

Обсуждение

Обеспокоенность здоровьем GSD получила широкую огласку [34, 35]. У GSD было наибольшее количество опубликованных данных о предрасположенности к наследственным заболеваниям среди 50 наиболее часто регистрируемых пород Кеннел-Клуба и было второе место по количеству нарушений, усугубляемых экстерьером, уступая только немецкому догу [36]. Система наблюдения за породой Британского клуба собаководства относит овчарку к третьей категории, «требующей особого наблюдения и дополнительной поддержки», и считается, что она более восприимчива к развитию определенных состояний здоровья, связанных с преувеличенным экстерьером.Причины, вызывающие беспокойство при наблюдении за породой, включают коровьи скакательные суставы, чрезмерный поворот коленных суставов, нервный темперамент, серповидные скакательные суставы и слабые задние конечности [37].

Высококачественная сборка генома расширит знания о конкретных породах болезней, таких как ИБС, и распространится на вопросы, связанные с личностью собак. Тяжесть ИБС зависит как от генетических факторов, так и от факторов окружающей среды. В GSD оценки наследуемости ( h 2 ) варьировались от 0,1 до 0,6 [38]. На сегодняшний день разные популяции и методы исследования существенно влияют на результаты, потому что сообщаемые количественные характеристики ассоциации локусов и генов-кандидатов несовместимы между исследованиями [39–41].В то время как боксеры склонны к ИБС, оценки бедер «Таши» (используется для CanFam) неизвестны. Более того, специфичные для GSD SNP, а также важные CNV и SV трудно обнаружить. Что касается собачьей личности, Saetre et al. [42] исследовали, как черты передаются между поколениями в когорте, состоящей из> 10 000 собак, прошедших поведенческую проверку, GSD и ротвейлеров. У обеих пород было обнаружено, что образец совместного наследования похож на широкую черту личности, ранее называвшуюся застенчивостью-смелостью, с наследуемостью, оцененной как 0.25 в 2 породах. В настоящее время основные гены, участвующие в этом поведении, неизвестны.

Сборка, как ожидается, позволит выбирать GSD для выполнения определенных задач, включая работу в полиции, где их чувствительный нос часто используется для распознавания запахов. Робин и др. [43] проанализировали нуклеотидные последовательности 109 генов OR (102 гена и 7 псевдогенов) у 6 различных пород, включая GSD. В этом исследовании они показали, что гены OR очень полиморфны, в среднем 1 SNP на 577 нуклеотидов.Однако степень наблюдаемого полиморфизма сильно варьируется: некоторые OR-гены имеют мало SNP, а другие имеют высокую степень полиморфизма (1 SNP / 122 нуклеотида). Ян и др. [44] провели предварительное исследование 22 SNP из экзонных областей 12 генов OR в GSD и обнаружили значительную корреляцию между генотипами SNP генов OR и обонятельными способностями собак.

Мы предполагаем, что эти данные также помогут понять эволюцию пород собак и собак в целом.Эволюционное положение GSD среди существующих пород окончательно не установлено. Международная кинологическая федерация помещает его в группу 1 как часть группы Herding. Bigi et al. [45] предположили, что немецкая овчарка была тесно связана с чехословацкой волчьей собакой. Совсем недавно Parker et al. [6] предположили, что GSD отличается от других пастушьих пород и находится в кладе вместе с французским Berger Picard, New Hampshire Chinook, перуанской голой и мексиканской ксолоитцкуинти.

Выводы

Эта сборка и аннотация генома de novo станет неоценимым инструментом для углубления знаний о болезнях, специфичных для каждой породы, и об эволюционном сходстве GSD. Здесь мы представляем улучшенную сборку и аннотацию генома псовых по сравнению с CanFam 3.1.

Методы

Экстракция ДНК, секвенирование и скаффолдинг

Образец: Немецкая овчарка Нала

При выборе животного для проекта было сочтено важным выбрать самку, которая была очищена, насколько это возможно, от любых распознаваемых наследственных заболеваний.Животное должно обладать всеми признаками качественного представителя породы, но не обязательно должно быть экземпляром, выигравшим выставку. Нала — добродушная и доступная девочка в возрасте 5,5 лет (родилась 5 декабря 2013 года) и любимое домашнее животное, которое показало типичную внешность для немецкой овчарки. У нее не было никаких признаков дисплазии тазобедренного сустава, которая проявляется при GSD (дополнительный рис. 6) или каких-либо других известных генетических заболеваний. У Налы была комбинированная оценка бедра 3 (1 слева и 2 справа), когда рентген был сделан в возрасте 5 лет: каждое бедро было измерено по шкале от 0 до 53, с в общей сложности 106 человек являются инвалидами.Оценка 3 значительно ниже текущего среднего показателя по Австралии, равного 9 для GSD. Она зарегистрирована в Австралийском национальном совете по собаководству (# 2100398550), ее мать от австралийских линий разведения и отец импортирован из Германии. Ее мать и отец остаются здоровыми стареющими взрослыми без болезней. У матери Налы 7 потомков, рентгенограмм которых не выявлено, от 4-х производителей без сбоев. У ее отца было 31 потомство, полученное на рентгенограмме от 13 разных дам, в результате 4 неудач и 27 передач были зарегистрированы для схемы бедра Национального совета GSD.В австралийской схеме начисления очков с 53 очками результат составляет ≤8 на любом 1 бедре, ни один балл не получает 3, а всего ≤16.

Pacific Biosciences SMRT секвенирование

Геномную ДНК получали из 1-2 мл свежей крови с использованием набора genomic-tip 100 / G (Qiagen, Hilden, Германия). Это выполняли с дополнительной обработкой РНКазой (Astral Scientific, Тарен-Пойнт, Австралия) и протеиназой К (NEB, Ипсвич, Массачусетс, США) в соответствии с инструкциями производителя. Изолированную геномную ДНК дополнительно очищали с использованием гранул AMPure XP (Beckman Coulter, Бреа, Калифорния, США) для устранения ингибиторов секвенирования.Чистоту ДНК рассчитывали с использованием спектрофотометра Nanodrop (Thermo Fisher Scientific, Уолтем, Массачусетс, США), а молекулярную целостность оценивали с помощью гель-электрофореза в импульсном поле. Целостность ДНК оценивалась Sage Science Pippin Pulse. Гель 0,75% KBB (Sage Science, Беверли, Массачусетс, США) прогоняли по 9-часовой программе 10–48 кб (80 В). Используемая лестница ДНК представляла собой лестницу ДНК расширения Invitrogen 1 kb (каталожный номер 10,511–012). Всего на гель наносили 150 нг ДНК.

Мы создали 2 библиотеки, размер которых был выбран на гелях Sage BluePippin (Sage Science, Беверли, Массачусетс, США).Библиотеки секвенировали на машинах Sequel с химическим составом 2.0, записывающим 10-часовые фильмы (PacBio Sequel System, RRID: SCR_017989). Секвенирование было проведено в Центре сравнительной геномики Рамачотти при Университете Нового Южного Уэльса (TOW5157A1, 15 клеток SMRT с общей длиной считывания полимеразы 108,48 ГБ) и в Геномном институте Аризоны при Университете Аризоны (4 клетки SMRT, всего 11 Гб данных; примечание: короткие чтения были вызваны срезанием ДНК во время доставки из Австралии в Аризону).

ONT PromethION секвенирование
ДНК

(1 мкг) получали для секвенирования ONT с использованием 1D геномной ДНК с помощью набора для лигирования (SQK-LSK109, ONT) в соответствии со стандартным протоколом. Для окончательной элюции использовали буфер для длинных фрагментов, чтобы исключить фрагменты короче 1000 п.н. Всего 119 нг адаптированной ДНК загружали в проточную кювету FLO-PRO002 PromethION и прогоняли на устройстве секвенирования ONT PromethION (PromethION, RRID: SCR_017987) с использованием MinKNOW (18.08.2) с ядром MinKNOW (v1.14.2).

Вызов базы был выполнен после секвенирования с помощью программы guppy basecaller с поддержкой графического процессора (v3.0.3) с использованием высокоточной модели триггера PromethION с конфигурацией «dna_r9.4.1_450bps_hac.cfg».

10X Genomics Chromium секвенирование
ДНК

получали в соответствии с протоколом, описанным выше для секвенирования SMRT. Библиотека 10X GEM была закодирована штрих-кодом из ДНК с высокой молекулярной массой (HMW) в соответствии с протоколами, рекомендованными производителем. В качестве протокола использовалось Руководство пользователя наборов реагентов для генома хрома версии 2, часть руководства №CG00043 Ред. B [46]. Контроль качества выполняли с использованием LabChip GX (PerkinElmer, Уолтем, Массачусетс, США) и флурометра Qubit 2.0 (Life Technologies, Карлсбад, Калифорния, США) в Центре клинической геномики Кингхорна. Библиотека запускалась на одной дорожке проточной ячейки с узором v2. Парное секвенирование с длиной считывания 150 п.н. выполняли с использованием Illumina HiSeq X (Illumina HiSeq X Ten, RRID: SCR_016385) в Центре клинической геномики Кингхорна при Институте медицинских исследований Гарвана, Сидней, Австралия.

ДНК-метилом

Чтобы изучить регуляторный ландшафт GSD, мы выполнили полногеномное бисульфитное секвенирование [47] на геномной ДНК, выделенной из цельной крови. Как и у других взрослых позвоночных [48, 49], геном GSD демонстрирует типичный бимодальный паттерн метилирования ДНК:> 60% динуклеотидов CpG метилированы на уровнях> 80% (гиперметилированы), а 12% динуклеотидов CpG метилированы на уровне ≤20 % (гипометилированный). Затем, чтобы определить количество и геномное распределение предполагаемых регуляторных областей, мы сегментировали метилом на неметилированные области (UMR) и низкометилированные области (LMR), используя алгоритм MethylSeekR [50].UMRs полностью неметилированы и в значительной степени совпадают с промоторами CpG-островков, тогда как LMRs обнаруживают частичное метилирование ДНК, которое характерно для дистальных регуляторных элементов, таких как энхансеры, в других моделях млекопитающих [51]. Эти анализы привели к идентификации ~ 21 000 UMR и ~ 53 000 LMR в соответствии с ранее сообщенными количествами промоторов и энхансеров [50, 52] (дополнительный рис. 7).

Оптическое отображение Bionano
ДНК

HMW выделяли из свежей крови (хранящейся при 4 ° C) с использованием протокола выделения ДНК крови Bionano Prep (Bionano Genomics [BNG], документ № 30,033, редакция C). Вкратце, после лизирования эритроцитов белые кровяные тельца выделяли и помещали в агарозные пробки. Эти пробки подвергали расщеплению протеиназой К (Qiagen Cat No. 158,920) в течение 2 циклов (2 часа, затем в течение ночи) при 50 ° C. После тщательной промывки, как предписано в протоколе, пробки плавили и обрабатывали ферментом GELase (Epicenter, кат. № G31200). Полученную ДНК HMW подвергали капельному диализу, оставляли для уравновешивания при комнатной температуре в течение 4 дней, а затем количественно определяли с использованием набора для анализа дцДНК Qubit Broad Range (Thermo Fisher Scientific).

ДНК HMW (~ 190 нг / мкл) метили (BNG, номер детали 20,351) в сайтах узнавания DLE-1 в соответствии с протоколом прямой метки и окрашивания Bionano PrepTM (BNG, документ № 30,206, редакция C). Меченую ДНК загружали непосредственно на чипы Bionano Saphyr (BNG, Part No. 20,319) без дальнейшей фрагментации или амплификации и отображали с помощью прибора Saphyr для создания оптических карт одиночных молекул (Saphyr, RRID: SCR_017992). Было выполнено несколько циклов для достижения средней глубины охвата необработанного генома 190 ×.

Каркас длины хромосомы Hi-C

Сборка Bionano была дополнительно закреплена до длины хромосомы в ДНК-зоопарке в соответствии с предписанной методологией [53]. Вкратце, библиотека in situ Hi-C была приготовлена ​​[54] из образца крови чистокровного самца по имени Тайдус (регистрационный номер Американского клуба собаководства DN5364660), предоставленного Корнельским ветеринарным биобанком, и секвенирована до 29-кратного покрытия (при условии, что 2,4- Размер генома Gb).

Рабочий процесс сборки генома

Сборка длинночитываемого генома

Чтения SMRT и ONT были исправлены и собраны с помощью ассемблера Canu (Canu, RRID: SCR_015880) v1. 8.0 [18]. Полученные контиги были отполированы путем совмещения необработанных считываний со сборкой и исправления ошибок секвенирования с использованием 2 раундов полировки Arrow [19]. В первом раунде было ~ 10 миллионов исправлений, а во втором — ~ 284 000 исправлений. Собранный геном GSD общей длиной 2,39 ГБ состоял из 1389 контигов с длиной N50 15,68 МБ. После полировки Arrow было 1389 последовательностей общей длиной 2,39 ГБ (включая 111 повторов общей длиной 13 145025 пар оснований) без пузырьков.Было обнаружено 2 560 498 несобранных последовательностей общей длиной 17 998 063 955 п.н.

10X Chromium link reads

Сборка SMRT / ONT с полировкой Arrow была создана с использованием связанных считываний GSD 10X, как в ARCS [55]. Данные 10X были выровнены с использованием программного обеспечения для анализа связанного чтения, предоставленного 10X Genomics, Long Ranger, v2.1.6 [56]. Неверно согласованные чтения и чтения, не отображаемые на концы контигов, были удалены, и все возможные соединения между контигами были вычислены с сохранением наилучших взаимных соединений.Наконец, последовательности контигов были объединены, разнесены на 10 т.п.н. с участками из N и, если необходимо, обратным образом дополнены (дополнительный файл 3). Всего можно было установить 128 соединений между контигами SMRT / ONT, увеличив длину сборки N50 на 4,6 Мб (с 15,46 до 20,06 Мб; дополнительный файл 3).

Круглый полировальный 1

Для дальнейшего улучшения сборки был проведен еще один раунд полировки путем совмещения коротких считываний Illumina из последовательности 10X Chromium со сборкой с использованием minimap2 [57] (v2.16) и исправление ошибок секвенирования с помощью Racon (Racon, RRID: SCR_017642) v1.3.3 [58].

Оптическое картирование супер-строительных лесов с использованием данных Bionano

Одномолекулярные оптические карты фильтровали по минимальной длине молекулы 150 т. п.н. и минимум 9 сайтов метки на молекулу. De novo Сборку единичных молекул в консенсусные карты проводили с использованием программы Bionano Solve (v3.2.2_08022018) с выравнивателем RefAligner (7782.7865rel) [59, 60].Сборка происходила «без знания гаплотипа», так что гетерозиготные аллели сводились к гаплоидному представлению. Всего около 2 миллионов одиночных молекул с N50 размером 220 т.п.н. были собраны в 1245 оптических карт генома с N50 размером 3,1 МБ. Финальная сборка была в формате CMAP (v0.2).

Этот набор геномных карт использовали для каркаса контигов последовательностей с использованием конвейера гибридных каркасов BNG (v10252018). Вкратце, 1261 контиг последовательностей был расщеплен in silico на основе мотива DLE-1 (CTTAAG), создающего карты последовательностей (CMAP).Затем карты последовательностей были сопоставлены с собранными оптическими картами на основе меток DLE-1 с использованием RefAligner. Были созданы карты дискретных последовательностей, которые можно связать через карту генома Bionano.

Совмещения, указывающие на конфликт между последовательностью и оптическими картами и, следовательно, на неправильную сборку, были устранены. В частности, оптические карты, поддерживаемые ≥10 одиночными молекулами в месте конфликта, указывали на неправильную сборку последовательностей, и поэтому карта последовательности будет «разрезана» (разделена) в точке конфликта.Напротив, недостаточная поддержка одной молекулы для оптической карты свидетельствует об ошибке сборки оптической карты, и поэтому оптическая карта будет «вырезана» в месте конфликта. Подробности метода представлены в Теории работы Bionano Solve: гибридный каркас (документ № 30,073). После гибридного каркаса 21 произвольный N-пробел размером 10 т.п.н. (введенный в процессе сборки последовательности) был изменен на основе оцененных расстояний между метками на оптических картах. Всего 160 контигов последовательностей были гибридизованы в 109 гибридных каркасов с N50, равным ~ 46. 3 Мб. Остальные 1004 контига последовательностей с N50 ~ 78,8 т.п.н. не могли быть скаффолдинги либо потому, что они были слишком короткими (<100 т.п.н.) для гибридного каркаса с картами Bionano, либо потому, что они не совпадали с какими-либо оптическими картами.

Сборка длины хромосомы с использованием данных Hi-C

Данные Hi-C были обработаны с помощью соковыжималки (Juicer, RRID: SCR_017226) [61] и использованы в качестве входных данных в конвейер 3D-ДНК [62] для получения сборки генома-кандидата по длине хромосомы. Мы выполнили дополнительную отделку строительных лесов с помощью инструмента для сборки Juicebox Assembly Tools [63].На рис. 3 показаны контактные матрицы, созданные путем согласования набора данных Hi-C с сборкой генома до обновления Hi-C (слева) и после создания каркасов Hi-C (справа). Матрицы визуализируются в Juicebox.js, облачной системе визуализации данных Hi-C [64], и доступны для просмотра в различных разрешениях в DNA Zoo [65].

Рисунок 3:

GSD в сборе до и после коррекции Hi-C. Контактные матрицы (визуализированные в Juicebox.js), сравнивающие сборку GSD до и после обновления Hi-C по длине хромосомы.

Рисунок 3:

GSD в сборе до и после коррекции Hi-C. Контактные матрицы (визуализированные в Juicebox.js), сравнивающие сборку GSD до и после обновления Hi-C по длине хромосомы.

Заполнение зазора

После построения и исправления все необработанные чтения SMRT и ONT были согласованы с сборкой с помощью Minimap2 (v2.16) (-ax map-pb / map-ont) и использованы PBJelly (pbsuite v.15.8.24) [66] чтобы заполнить пробелы. Он смог полностью закрыть 210 пробелов, увеличив контиг N50 до конечной цифры 20.9 Мб.

Круглый полировальный 2

После возведения строительных лесов была проведена еще одна полировка для дальнейшего улучшения сборки. Полировка была выполнена путем сопоставления коротких считываний Illumina из секвенирования Chromium с сборкой с использованием Long Ranger v2.2.2 и корректировки SNP и вставок с помощью Pilon (Pilon, RRID: SCR_014731) [20].

Окончательная очистка

Полированный с помощью Pilon геном подвергся окончательной очистке каркаса для создания высококачественной сборки ядра, удаления артефактов с низким уровнем покрытия и последовательностей гаплотигов и аннотирования оставшихся каркасов с потенциальными проблемами.

Фильтр с малым покрытием

Подпотоки PacBio библиотеки TOW5157A1 (12,5 млн подпотоков; 108 ГБ) были отображены на сборку Nala_canu_arrow2_10x_racon_bionano_HiC_pbjelly_pilon с использованием Minimap2 v2.16 (-ax map-pb –secondary = no) [57]. Первоначальный анализ глубины чтения был выполнен с помощью BBMap v38.51 pileup.sh [67]. Любые каркасы со средним покрытием <3 (например, <50% каркаса, покрытого ≥3 чтениями) были отфильтрованы как каркасы с низким покрытием. Из 1057 полированных Pilon каркасов 220 каркасов были удалены в первоначальном фильтре с низким охватом, в результате чего осталось 837 каркасов.

Анализ Purge Haplotigs — раунд 1

субпотоков были переназначены на оставшиеся 837 каркасов и обработаны с помощью PurgeHaplotigs v201 [68] (реализация Perl v5.28.0, BEDTools v2.27.1 [69], R v3.5.3 и SAMTools v1.9 [70]). На основе гистограммы глубины PurgeHaplotigs пороговые значения низкой, средней и высокой глубины были установлены на 5 ×, 30 × и 80 ×. Любые каркасы с <80% на глубине диплоидного считывания были идентифицированы PurgeHaplotigs для переназначения. Каркасы с ≥80% оснований в бункерах с низким / гаплоидным покрытием и ≥95% их длины, картированные PurgeHaplotigs на другой каркас, были отфильтрованы как гаплотиги или артефакты сборки. Любые другие каркасы с базами с низким покрытием ≥80% были отфильтрованы как «низкие покрытия». Этот анализ привел к дополнительным 11 каркасам, отфильтрованным для низкого покрытия и 268 отфильтрованным как гаплотиги или артефакты сборки, оставив 558 каркасов.

Анализ Purge Haplotigs — раунд 2

субпотоков были переназначены на оставшиеся 558 каркасов, в результате чего еще 128 каркасов были отфильтрованы как гаплотиги или артефакты сборки, оставив 430 каркасов. Никаких дополнительных каркасов с базами с низким покрытием ≥80% выявлено не было.Любые каркасы с ≥80% оснований в бункерах с низким / гаплоидным покрытием были отфильтрованы как гаплотиги или артефакты сборки. Каркасы с ≥20% диплоидным покрытием были отмечены как удерживающие как вероятные диплоиды. Каркасы с диплоидным покрытием <20% и высоким покрытием ≥50% были отмечены как вероятные коллапсирующие повторы. Единственный оставшийся каркас, помеченный PurgeHaplotigs как «мусор» (> 80% низкий / высокий охват), также был отфильтрован как вероятный артефакт.

Анализ Purge Haplotigs — раунд 3

субпотоков были повторно отображены на оставшиеся 430 каркасов для третьего раунда анализа PurgeHaplotigs.Других каркасов для фильтрации выявлено не было.

Картирование хромосомы CanFam3.1

Эталонный геном CanFam v3.1 был загружен с Ensembl (выпуск 97, дата загрузки 5 августа 2019 г.). Полноразмерные хромосомы были переименованы с префиксом CANFAMCHR и использованы для эталонного картирования. Окончательная сборка генома Nala была нанесена на карту эталонного генома CanFam3.1 с использованием Minimap2 v2.16 [57] (-x asm5 –secondary = no –cs) для генерации выходных данных PAF. Эшафоты были отнесены к CanFam3.1 с использованием PAFScaff v0.2.0 (PAFScaff, RRID: SCR_017976) [71] на основе покрытия каркаса сборки, выровненного по Minimap2, по сравнению с эталонными хромосомами. Каркасы были отнесены к хромосоме с наибольшим общим покрытием. Каркасы, не отображаемые на хромосоме, были оценены как «неразмещенные».

Окончательная классификация лесов

Подрезы

были переназначены на переименованные и переориентированные скаффолды для заключительного раунда анализа PurgeHaplotigs для классификации скаффолдов, которые могли избежать фильтрации или иметь необычный профиль глубины чтения.Каркасы были разделены на 1 из 5 категорий:

  1. DIPLOID (core) каркасы имеют <50% совпадения с другим каркасом, а доминирующим бункером покрытия PurgeHaplotigs является глубина диплоида

  2. REPEAT каркасы имеют> 50% совпадения с другим каркасом и доминантный интервал покрытия PurgeHaplotigs — глубина диплоида

  3. COLLAPSED_REPEAT скаффолды имеют высокий охват PurgeHaplotigs bin доминирующий

  4. Области HAPLOID имеют ≥50% совпадение с другим каркасом, и доминирующим критерием глубины охвата PurgeHaplotigs не является интервал охвата метаданных, но доминирующий критерий глубины охвата PurgeHaplotigs не соответствует диапазону глубины покрытия Haplotigs.

  5. НИЗКОКАЧЕСТВЕННЫЕ каркасы имеют ≥50% совпадение с другим каркасом, а доминирующим бункером покрытия PurgeHaplotigs является низкая глубина покрытия, но критерии фильтрации не были выполнены

Наконец, 20 каркасов REPEAT, соответствующих контрольной последовательности PacBio, были удалены из сборка, оставляя последние 409 ядерных каркасов плюс митохондрии.Семнадцать каркасов имели небольшие области, замаскированные или обрезанные с помощью скрининга NCBI Contamination, соответствующие фрагменту Escherichia coli размером 3,4 т.п.н.

Прогнозирование генов, включая аннотацию повторяющихся элементов

Геном аннотировали с использованием программы прогнозирования генов на основе гомологии GeMoMa (GeMoMa, RRID: SCR_017646) v1. 6.2beta [27] и 9 эталонных организмов. 9 видов, использованных для анализа предсказания генов на основе гомологии, были C. lupus familis (CanFam3.1; GCF_000002285.3), Vulpes vulpes (VulVul2.2; GCF_003160815.1), Felis catus (Felis_catus_9.0; GCF_000181335.3), Sus scrof (Sscrofa11.1; GCF_0000043025) (ARS-UCD1.2; GCF_002263795.1), Ailuropoda melanoleuca (ASM200744v1; GCF_000004335.2), Ursus maritimus (UrsMar_1.0; GCA_000687225.1), p. 26) и Homo sapiens (GRCh48.p13; GCA_000001405.39), которые были загружены из NCBI.

Для каждого эталонного организма кодирующие экзоны полноразмерного транскрипта экстрагировали и транслировали в пептиды с использованием модуля GeMoMa Module Extractor. Эти пептиды были исследованы в геноме GSD с использованием mmseqs2 [72] (v5877873cbcd50a6d

7fc2df1210f8c2c3a4b). На основании результатов mmseqs2 и Extractor, транскрипты были предсказаны для GSD от каждого эталонного организма независимо. Затем эти 9 наборов аннотаций генов были объединены в окончательную аннотацию генов с использованием модуля GeMoMa GAF.

Гены рибосомной РНК (рРНК) были предсказаны с помощью Barrnap v0.9 (Barrnap, RRID: SCR_015995) [73] в эукариотическом режиме, HMMer v3.2.1 (Hmmer, RRID: SCR_005305) [74] и BEDTools v2.27. (BEDTools, RRID: SCR_006646) [69].

Наличие подтверждающих данных и материалов

Полная сборка генома доступна в NCBI (номер доступа в GenBank GCA_008641055.2). Данные о метилировании ДНК Номер GEO: GSE136348. PAFScaff (PAFScaff, RRID: SCR_017976) имеет лицензию GPLv3 и зарегистрирован на сайте bio.инструменты (биологические инструменты: PAFScaff_Pairwise_mApping_Format_reference-based_scaffold_anchoring_and_super-scaffolding.) [75]. Все подтверждающие данные и материалы также доступны в базе данных GigaScience GigaDB [76].

Дополнительные файлы

Дополнительный файл 1 : Анализ глубины считывания области Amy2B

Дополнительный файл 2 : Bionano AMY2B методы

Дополнительный файл 3 : детали рабочего процесса хрома 10X

Дополнительный рисунок 1 рабочего процесса проекта. ДНК немецкой овчарки («Нала» или Йонкахра нала) была получена из крови одной самки. Ее мать, Jonkahra Lets Elope, происходила из Австралии, а ее отец, CH Arkon Vom Altenberger Land, был импортирован из Германии. Последовательности были сгенерированы с помощью прибора Pacific Biosciences Sequel (химия V2) и прибора Oxford Nanopore PromethION (guppy basecaller Version 3.0.6 + 9999d81) до примерно 30-кратного покрытия генома каждая на основе оценки размера генома в 2,4 Гб (эта оценка равна используется для всех оценок покрытия).Все долго считываемые последовательности были собраны с помощью алгоритма Canu v1.8, затем ошибки дважды исправлены с использованием модуля полировки геномного консенсуса Arrow. Сборка была скомпонована с помощью связанных считываний Chromium 10X (~ 41 × охват, исключая штрих-код) с использованием Long Ranger v2.1.6 с использованием ДНК от того же животного. Полировка сборки на предмет остаточных дефектов была выполнена путем согласования данных Illumina с Minimap2 и алгоритмом Racon. Затем данные по одной молекуле Bionano (~ 57 × эффективное покрытие) были использованы для суперсэффолдинга сборки последовательности с использованием ДНК, выделенной из того же псового.Для этого были сначала оптические карты одиночных молекул de novo , собранные в консенсусные карты, которые затем были сопоставлены со сборкой последовательности in silico , расщепленной тем же ферментом-меткой для гибридного каркаса, с использованием Bionano Solve (v3.2.2_0 802 2018) с RefAligner (7782.7865rel). Эта сборка была дополнительно скомпонована до длины хромосомы с помощью ДНК-зоопарка в соответствии с методологией, описанной здесь: www.dnazoo.org/methods. Вкратце, библиотеку in situ Hi-C получали из образца крови чистокровного самца GSD по имени Tydus и секвенировали до 29-кратного покрытия.Данные Hi-C обрабатывались с помощью соковыжималки и использовались в качестве входных данных в конвейер 3D-ДНК для создания сборки генома-кандидата по длине хромосомы. Мы выполнили дополнительную отделку строительных лесов с помощью сборочного инструмента Juicebox Assembly Tools. Затем сборка была заполнена с помощью алгоритма PBJelly для длительного чтения, а ошибка дополнительных данных исправлена ​​с помощью Arrow. Данные Chromium были отображены на сборке с помощью программы Long Ranger v2.1.6, а затем окончательная сборка была отполирована с использованием алгоритма Pilon.В собранном геноме размером 2,4 ГБ (German_Shepherd_breed-1.0) общая длина сборки N50 контига и каркаса составляет 23,1 и 64,3 МБ соответственно. Геном аннотировали с использованием программы предсказания генов на основе гомологии GeMoMa (версия 1.6.2beta) и 9 эталонных организмов. Затем собранные контиги выравнивали с CanFam3.1 для определения хромосом.

Дополнительный рисунок 2 : BUSCO улучшает качество сборки на каждом этапе анализа. а . Рейтинги BUSCO на разных этапах сборки Nala по сравнению с CanFam 3.1. См. Дополнительную таблицу 1 для описания этапов сборки. C: полный; S: единственный экземпляр; D: дублированный; F: фрагментированный; М: отсутствует; n: Нет. Гены BUSCO. б . Отсутствующие гены BUSCO (%) по сравнению с каркасом NG50 (размер генома 2,41 ГБ). Фиолетовый: оригинальная сборка; черный: строительные леса / полировка ступеней; синий: окончательная сборка; красный: CanFam 3.1. Пунктирными красными линиями отмечена статистика CanFam 3.1.

Дополнительный рисунок 3 : KAT k -мерный анализ сборки Nala. Распределение частот 10X чтения k -mer для k -меров с разными номерами копий сборки, полученными из (A), Read 1 (штрих-коды 16 bp обрезаны) и (B) Read 2 (штрих-коды не обрезаны).

Дополнительный рисунок 4 : карты консенсуса Bionano, согласованные с контигом GSD NALACHR6.01. На контиге GSD (зеленая полоса) наложены 4 предсказанных GeMoMa транскрипта AMY2B, помеченных R0 – R3. Ниже и выше пары аллелей консенсусной карты Bionano (синие полосы) представляют собой одиночные молекулы (оранжевые линии), поддерживающие сборку карты генома. Темно-синие и желтые вертикальные линии на контигах последовательностей и консенсусной карте указывают на совпадающие и несовпадающие ферментативные метки DLE1, соответственно. Ферментативные метки DLE1 на отдельных молекулах показаны темно-синими или светло-оранжевыми точками для совпадающих и несовпадающих меток, соответственно.Оба аллеля геномной карты несут «вставку» размером ~ 11 т.п.н. выше повтора AMY2B (выделено бирюзовым цветом) и тандемную дупликацию размером ~ 54,6 т.п.н., отмеченную метками DLE1 в положениях 47 341 704 и 47 396 280 контига GSD NALACHR6.01.

Дополнительный рисунок 5 : Консенсусные карты Bionano согласованы с CanFam3 Chr6. По сравнению с CanFam3, гомозиготные аллели геномной карты Bionano, карты № 1111 и 1112, оба содержат вставку размером ~ 100 т.п.н., фланкированную метками DLE1 на 464 и 46999962 на хромосоме 6.

Дополнительный рисунок 6 : Рентгеновский снимок бедра немецкой овчарки Нала. Ее общий балл по бедрам 3 (1 слева и 2 справа), когда рентген был сделан в возрасте 5 лет: каждое бедро было измерено по шкале от 0 до 53, всего 106 баллов. быть калечащим. Этот показатель значительно ниже текущего среднего показателя по Австралии, равного 9 для GSD.

Дополнительный рисунок 7 : Профиль метилирования ДНК цельной крови немецкой овчарки Нала. ( A ) Процент динуклеотидов CpG с разными уровнями метилирования.Высокий, 80–100%; средний, 20–80%; низкий,> 0–20%; нет, 0. ( B ) Сегментация гипометилированных областей на CpG-богатые неметилированные области (UMR) и CpG-бедные низкометилированные области (LMR). Показано количество CpG (log 2 ) на область относительно ее медианного метилирования. ( C ) Средние профили метилирования ДНК UMR и LMR. (D) Дорожка браузера IGV, отображающая профиль MC и предполагаемые регулирующие элементы.

Дополнительная таблица 1 : Сводная статистика сборочных лесов и BUSCO для различных этапов сборки Nala, CanFam 3.1 и составили лучшие рейтинги.

Дополнительная таблица 2 : рейтинг гена BUSCO для различных стадий сборки Nala, CanFam 3.1 и составленные лучшие рейтинги.

Дополнительная таблица 3 : Обзор SNV GSD и небольших индексов по хромосомам.

Дополнительная таблица 4 : Сводка количества копий GSD и структурных вариантов (> 100 п.н.) по хромосомам.

Сокращения

BLAST: Базовый инструмент поиска локального выравнивания; BMG: Bionano Genomics; bp: пары оснований; BUSCO: Бенчмаркинг универсальных ортологов единственной копии; ИБС: дисплазия тазобедренного сустава у собак; CNV: вариант номера копии; Gb: пары гигабаз; GPU: графический процессор; GSD: немецкая овчарка; HMM: скрытая марковская модель; HMW: высокая молекулярная масса; kb: пары килобаз; LMR: низкометилированная область; Mb: пары мегабаз; мРНК: информационная РНК; NCBI: Национальный центр биотехнологической информации; ONT: Oxford Nanopore Technologies; ИЛИ: обонятельный рецептор; ORF: открытая рамка считывания; PacBio: Pacific Biosciences; КПЦР: количественная полимеразная цепная реакция; рРНК: рибосомная РНК; SMRT: одиночная молекула в реальном времени; SNP: однонуклеотидный полиморфизм; SNV: однонуклеотидный вариант; SV: вариант конструкции; UMR: неметилированная область.

Утверждение этических норм и согласие на участие

Все эксперименты проводились с одобрения этического комитета Университета Нового Южного Уэльса (ACEC ID: 18 / 18B).

Конкурирующие интересы

Авторы заявляют, что у них нет конкурирующих интересов.

Финансирование

Эта работа была поддержана премией Австралийского фонда здравоохранения и инициативой Hip2Fit Crowdfunding Дж. W.O.B. и Р.З. Соответствующие средства были предоставлены Университетом Нового Южного Уэльса / Школой биотехнологии и биомолекулярной инициативы по геномике. V.M.H. профинансировал сбор данных Bionano. Строительные леса Hi-C были выполнены и профинансированы Консорциумом зоопарка ДНК. M.A.F. финансируется NHMRC APP5121190. E.L.A. был поддержан премией NSF Physics Frontiers Center Award (PHY1427654), Welch Foundation (Q-1866), грантом Министерства сельского хозяйства и пищевых исследований Министерства сельского хозяйства США (2017–05741), грантом NIH 4D Nucleome Grant (U01HL130010) и энциклопедией NIH Премия Центра картирования элементов ДНК (UM1HG009375).Центр геномики Рамачотти признает финансирование инфраструктуры Австралийским исследовательским советом (LE150100031), схемой NCRIS правительства Австралии, находящейся в ведении Bioplatforms Australia, и Программой привлечения и ускорения исследований правительства Нового Южного Уэльса.

Вклад авторов

J.W.O.B. согласовал проект. M.A.F., B.D.R., T.P.L.S. и J.W.O.B. разработал исследование. J.W.O.B профинансировал проект. R.A.Z. предоставил образцы GSD.R.L. и D.T. выполнили экстракцию геномной ДНК. К.Б. и M.A.S. выполнили секвенирование ONT и R.L., оптическое картирование Bionano. B.D.R. выполнил первоначальную сборку и полировку, A.E.R. выполнили строительные леса из хрома, а E.K.F.C и V.M.H. выполнила супер-строительные леса Bionano. О.Д., А.О. и З.К. выполнил эксперимент Hi-C, а О. и E.L.A. провели анализ Hi-C. К.С. и О. провели анализы метилирования ДНК. M.A.F. и R.E выполнили все анализы полноты генома.R.E. выполнили окончательную полировку, окончательную очистку сборки и анализ KAT. J.K. выполнил аннотацию генома. R.E. выполняли аннотацию рРНК. R.E., E.K.F.C. и B.D.R. выполнили анализов AMY2B . M.A.F., B.D.R., O.D., R.E., A.E.M., E.K.F.C., O.B. и J.W.O.B. написал рукопись. Все авторы отредактировали и одобрили окончательную рукопись.

БЛАГОДАРНОСТЬ

Комментарии 2 рецензентов улучшили рукопись. Мы хотели бы поблагодарить Хелайю-Хендерсон Смит за частый доступ к Нале.Персонал Ветеринарной больницы Виноградника постоянно поддерживал меня. Джеймс Фергюсон сыграл важную роль в содействии сбору данных ONT. Образец цельной крови для подготовки библиотеки Hi-C был предоставлен Susan Garrison LVT, BT, координатором сбора образцов, Корнельский ветеринарный биобанк. Секвенирование SMRT было проведено в Центре сравнительной геномики Рамачотти при Университете Нового Южного Уэльса и в Геномном институте Аризоны при Университете Аризоны. Данные геномики ONT, 10X Chromium и Bionano были собраны в Институте Гарвана, а данные Hi-C — в Медицинском колледже Бейлора.

Список литературы

1.

Frantz

LA

,

Mullin

VE

,

Pionnier-Capitan

M

и др. .

Геномные и археологические данные свидетельствуют о двойном происхождении домашних собак

.

Наука

.

2016

;

352

(

6290

):

1228

31

. 2.

Freedman

AH

,

Gronau

I

,

Schweizer

RM

и др..

Секвенирование генома подчеркивает динамичную раннюю историю собак

.

PLos Genet

.

2014

;

10

(

1

):

e1004016

. 3.

Savolainen

P

,

Zhang

YP

,

Luo

J

и др. .

Генетическое свидетельство восточноазиатского происхождения домашних собак

.

Наука

.

2002

;

298

(

5598

):

1610

3

.4.

Thalmann

O

,

Shapiro

B

,

Cui

P

и др. .

Полные митохондриальные геномы древних псовых предполагают европейское происхождение домашних собак

.

Наука

.

2013

;

342

(

6160

):

871

4

. 5.

Vonholdt

BM

,

Pollinger

JP

,

Lohmueller

KE

и др..

Анализ SNP и гаплотипов по всему геному показывает богатую историю, лежащую в основе одомашнивания собак.

.

Природа

.

2010

;

464

(

7290

):

898

902

.6.

Parker

HG

,

Dreger

DL

,

Rimbault

M

и др. .

Геномный анализ показывает влияние географического происхождения, миграции и гибридизации на развитие современных пород собак

.

Сотовый представитель

.

2017

;

19

(

4

):

697

708

. 7.

Talenti

A

,

Dreger

DL

,

Frattini

S

и др. .

Исследования современных итальянских популяций собак выявили несколько закономерностей эволюции домашних пород

.

Ecol Evol

.

2018

;

8

(

5

):

2911

25

. 8.

Уиллис

МБ

.

Немецкая овчарка: история, развитие и генетика

.

Нью-Йорк

:

Arco

;

1977

.9.

Саммс

S

.

Немецкая овчарка: подробное руководство по содержанию и уходу за собакой

.

Лондон

:

Книги Клуба собаководства

;

2003

.10.

Benninger

MI

,

Seiler

GS

,

Robinson

LE

и др..

Трехмерная картина движений хвостовой поясничной и пояснично-крестцовой частей позвоночного столба собак

.

Am J Vet Res

.

2004

;

65

(

5

):

544

51

. 11.

Shaffer

LG

,

Ramirez

CJ

,

Phelps

P

и др. .

Международное генетическое исследование породных заболеваний у рабочих собак из США, Израиля и Польши

.

Cytogenet Genome Res

.

2017

;

153

(

4

):

198

204

. 12.

Boge

GS

,

Moldal

ER

,

Dimopoulou

M

и др. .

Восприимчивость породы к распространенным хирургическим лечением ортопедических заболеваний у 12 пород собак

.

Acta Vet Scand

.

2019

;

61

(

1

):

19

. 13.

Пейраван

A

,

Бертолини

F

,

Ротшильд

MF

и др..

Полногеномные ассоциативные исследования воспалительных заболеваний кишечника у немецких овчарок

.

PLoS Один

.

2018

;

13

(

7

):

e0200685

.14.

Soo

M

,

Lopez-Villalobos

N

,

Worth

AJ

.

Наследственность и генетические тенденции оценки локтевого сустава, зарегистрированные в рамках схемы дисплазии локтевого сустава Новой Зеландии Ветеринарной ассоциации (1992-2013) у четырех пород собак

.

N Z Ветеринар J

.

2018

;

66

(

3

):

154

61

. 15.

Wah

lJM

,

Herbst

SM

,

Clark

LA

и др. .

Обзор наследственных болезней немецкой овчарки

.

Дж. Ветеринарное поведение

.

2008

;

3

:

255

65

. 16.

Christopherson

PW

,

Bacek

LM

,

King

KB

и др..

Две новые миссенс-мутации, связанные с гемофилией А в семье боксеров и немецкой овчарки

.

Ветеринарная клиника Патол

.

2014

;

43

(

3

):

312

6

. 17.

Шарифлоу

MR

,

Джеймс

JW

,

Николас

FW

и др. .

Генеалогическое исследование зарегистрированных австралийских пород собак

.

Ветеринар J

.

2011

;

189

(

2

):

203

10

.18.

Koren

S

,

Walenz

BP

,

Berlin

K

и др. .

Canu: масштабируемая и точная сборка с длинным считыванием за счет адаптивного взвешивания k-mer и разделения повторов

.

Genome Res

.

2017

;

27

(

5

):

722

36

. 20.

Walker

BJ

,

Abeel

T

,

Shea

T

и др..

Pilon: интегрированный инструмент для комплексного обнаружения вариантов микробов и улучшения сборки генома

.

PLoS Один

.

2014

;

9

(

11

):

e112963

,21.

Lindblad-Toh

K

,

Wade

CM

,

Mikkelsen

TS

и др. .

Последовательность генома, сравнительный анализ и структура гаплотипа домашней собаки

.

Природа

.

2005

;

438

(

7069

):

803

19

.22.

Simao

FA

,

Waterhouse

RM

,

Ioannidis

P

и др. .

BUSCO: оценка сборки генома и полноты аннотации с однокопийными ортологами

.

Биоинформатика

.

2015

;

31

(

19

):

3210

2

. 23.

Altschul

SF

,

Gish

W

,

Miller

W

и др..

Базовый инструмент поиска локального выравнивания

.

Дж Мол Биол

.

1990

;

215

(

3

):

403

10

. 24.

Финн

RD

,

Clements

J

,

Eddy

SR

.

Веб-сервер HMMER: интерактивный поиск сходства последовательностей

.

Нуклеиновые Кислоты Res

.

2011

;

39

(выпуск веб-сервера

):

W29

37

.25.

Станке

M

,

Morgenstern

B

.

AUGUSTUS: веб-сервер для предсказания генов у эукариот, который допускает определенные пользователем ограничения

.

Нуклеиновые Кислоты Res

.

2005

;

33

(выпуск веб-сервера

):

W465

7

. 26.

Mapleson

D

,

Garcia Accinelli

G

,

Kettleborough

G

и др. .

KAT: набор инструментов анализа K-mer для контроля качества наборов данных NGS и геномных сборок

.

Биоинформатика

.

2017

;

33

(

4

):

574

6

0,27.

Keilwagen

J

,

Hartung

F

,

Grau

J

.

GeMoMa: прогнозирование генов на основе гомологии с использованием сохранения положения интрона и данных последовательности РНК

.

Методы Мол Биол

.

2019

;

1962

:

161

77

. 28.

Marcais

G

,

Delcher

AL

,

Phillippy

AM

и др..

MUMmer4: быстрая и универсальная система выравнивания генома

.

PLoS Компьютер Биол

.

2018

;

14

(

1

):

e1005944

,29.

Чакраборти

M

,

Emerson

JJ

,

Macdonald

SJ

и др. .

Структурные варианты демонстрируют широко распространенную аллельную гетерогенность и вариацию формы сложных признаков

.

Нац Коммуна

.

2019

;

10

(

1

):

4872

.30.

Ollivier

M

,

Tresset

A

,

Bastian

F

и др. .

Вариация количества копий Amy2B показывает адаптацию крахмальной диеты у древних европейских собак.

.

Р Соц Открытые науки

.

2016

;

3

(

11

):

160449

,31.

Quignon

P

,

Giraud

M

,

Rimbault

M

и др. .

Репертуар обонятельных рецепторов собак и крыс

.

Биология генома

.

2005

;

6

(

10

):

R83

.32.

Balmer

P

,

Bauer

A

,

Pujar

S

и др. .

Кураторский каталог генов кератина собак и лошадей

.

PLoS Один

.

2017

;

12

(

8

):

e0180359

.33.

Olender

T

,

Fuchs

T

,

Linhart

C

и др..

Обонятельный субгеном собак

.

Геномика

.

2004

;

83

(

3

):

361

72

. 34.

Бейтсон

П

.

Независимое расследование собаководства

.

Кембридж

:

Кембриджский университет

;

2010

.35.

Руни

N

,

Сарган

D

.

Племенное собаководство в Великобритании: главная забота о благосостоянии?

.

Horsham, West Sussex

:

RSPCA

;

2008

,36.

Asher

L

,

Diesel

G

,

Summers

JF

и др. .

Наследственные дефекты породистых собак. Часть 1: нарушения, связанные со стандартами породы

.

Ветеринар J

.

2009

;

182

(

3

):

402

11

0,37.

Petazzoni

M

,

Piras

A

,

Jaeger

GH

и др..

Коррекция ротационной деформации стопы с внешней скелетной фиксацией у четырех собак

.

Ветеринарная служба

.

2009

;

38

(

4

):

506

14

0,38.

Hamann

H

,

Kirchhoff

T

,

Distl

O

.

Байесовский анализ наследственности дисплазии тазобедренного сустава у немецких овчарок

.

J Anim Breed Genet

.

2003

;

120

:

258

68

.39.

Sanchez-Molano

E

,

Woolliams

JA

,

Pong-Wong

R

и др. .

Количественное картирование локусов признаков дисплазии тазобедренного сустава собак и связанных с ней признаков у британских лабрадоров

.

BMC Genomics

.

2014

;

15

:

833

.40.

Zhu

L

,

Zhang

Z

,

Friedenberg

S

и др. .

Долгий (и извилистый) путь к открытию генов дисплазии тазобедренного сустава у собак

.

Ветеринар J

.

2009

;

181

(

2

):

97

110

.41.

Mikkola

LI

,

Holopainen

S

,

Lappalainen

AK

и др. .

Новые защитные и опасные локусы при дисплазии тазобедренного сустава у немецких овчарок

.

PLos Genet

.

2019

;

15

(

7

):

e1008197

.42.

Saetre

P

,

Strandberg

E

,

Sundgren

PE

и др..

Генетический вклад в индивидуальность собак

.

Гены поведения мозга

.

2006

;

5

:

240

8

. 43.

Робин

S

,

Tacher

S

,

Rimbault

M

и др. .

Генетическое разнообразие обонятельных рецепторов собак

.

BMC Genomics

.

2009

;

10

:

21

. 44.

Ян

M

,

Geng

GJ

,

Zhang

W

и др..

SNP генотипы генов обонятельных рецепторов, связанных с обонятельной способностью у немецких овчарок

.

Аним Генет

.

2016

;

47

(

2

):

240

4

. 45.

Bigi

D

,

Marelli

SP

,

Randi

E

и др. .

Генетическая характеристика четырех коренных итальянских пород овчарок и анализ их родства с космополитическими породами собак с использованием микросателлитных маркеров

.

Животное

.

2015

;

9

(

12

):

1921

8

. 47.

Urich

MA

,

Nery

JR

,

Lister

R

и др. .

Подготовка библиотеки MethylC-seq для полногеномного бисульфитного секвенирования с разрешением по основанию

.

Nat Protoc

.

2015

;

10

(

3

):

475

83

. 48.

Meissner

A

,

Mikkelsen

TS

,

Gu

H

и др..

Карты метилирования ДНК в масштабе генома плюрипотентных и дифференцированных клеток

.

Природа

.

2008

;

454

(

7205

):

766

70

. 49.

Bogdanovic

O

,

Smits

AH

,

de la Calle Mustienes

E

и др. .

Активное деметилирование ДНК в энхансерах во время филотипического периода позвоночных

.

Нат Генет

.

2016

;

48

(

4

):

417

26

.50.

Burger

L

,

Gaidatzis

D

,

Schubeler

D

и др. .

Идентификация активных регуляторных участков по данным метилирования ДНК

.

Нуклеиновые Кислоты Res

.

2013

;

41

(

16

):

e155

.51.

Stadler

MB

,

Murr

R

,

Burger

L

и др. .

ДНК-связывающие факторы формируют метилом мыши в дистальных регуляторных областях

.

Природа

.

2011

;

480

(

7378

):

490

5

,52.

Mo

A

,

Mukamel

EA

,

Davis

FP

и др. .

Эпигеномные сигнатуры нейронального разнообразия в головном мозге млекопитающих

.

Нейрон

.

2015

;

86

(

6

):

1369

84

. 54.

Rao

SS

,

Huntley

MH

,

Durand

NC

и др..

Трехмерная карта генома человека с разрешением в килобаз показывает принципы образования петель хроматина

.

Ячейка

.

2014

;

159

(

7

):

1665

80

. 55.

Yeo

S

,

Coombe

L

,

Warren

RL

и др. .

ARCS: каркасные проекты генома со связанными считываниями

.

Биоинформатика

.

2018

;

34

(

5

):

725

31

.57.

Li

H

.

Minimap2: попарное выравнивание нуклеотидных последовательностей

.

Биоинформатика

.

2018

;

34

(

18

):

3094

100

,58.

Vaser

R

,

Sovic

I

,

Nagarajan

N

и др. .

Быстрая и точная сборка генома de novo из длинных неисправленных считываний

.

Genome Res

.

2017

;

27

(

5

):

737

46

.59.

Hastie

AR

,

Dong

L

,

Smith

A

и др. .

Быстрое картирование генома в наноканальных массивах для очень полной и точной сборки последовательностей de novo комплекса Aegilops tauschii геном

.

PLoS Один

.

2013

;

8

(

2

):

e55864

0,60.

Лам

ET

,

Hastie

A

,

Lin

C

и др..

Картирование генома на массивах наноканалов для анализа структурных вариаций и сборки последовательностей

.

Нат Биотехнология

.

2012

;

30

(

8

):

771

6

.61.

Durand

NC

,

Robinson

JT

,

Shamim

MS

и др. .

Juicebox обеспечивает систему визуализации для карт контактов Hi-C с неограниченным увеличением

.

Клеточная система

.

2016

;

3

(

1

):

99

101

0,62.

Дудченко

О

,

Батра

СС

,

Омер

AD

и др. .

Сборка de novo генома Aedes aegypti с использованием Hi-C дает каркасы длиной хромосомы

.

Наука

.

2017

;

356

(

6333

):

92

5

0,63.

Дудченко

О

,

Шамим

МС

,

Батра

СС

и др..

Модуль «Инструменты для сборки соковыжималки» упрощает сборку de novo геномов млекопитающих с помощью каркасов длиной менее 1000 долларов

.

bioRxiv

.

2018

, DOI: 0,64.

Робинсон

JT

,

Тернер

D

,

Дюран

NC

и др. .

Juicebox.js предоставляет облачную систему визуализации данных Hi-C

.

Клеточная система

.

2018

;

6

(

2

), doi :.66.

Английский

AC

,

Richards

S

,

Han

Y

и др. .

Помните о пробеле: обновление геномов с помощью технологии длинного чтения Pacific Biosciences RS

.

PLoS Один

.

2012

;

7

(

11

):

e47768

0,68.

Roach

MJ

,

Schmidt

SA

,

Borneman

AR

.

Purge Haplotigs: переназначение аллельного контига для диплоидных геномных сборок третьего поколения

.

BMC Биоинформатика

.

2018

;

19

(

1

):

460

0,69.

Quinlan

AR

,

Холл

IM

.

BEDTools: гибкий набор утилит для сравнения геномных характеристик

.

Биоинформатика

.

2010

;

26

(

6

):

841

2

0,70.

Li

H

,

Handsaker

B

,

Wysoker

A

и др..

Последовательность Выравнивание / Формат карты и SAMtools

.

Биоинформатика

.

2009

;

25

(

16

):

2078

9

,72.

Штейнеггер

M

,

Кодирование

J

.

MMseqs2 позволяет искать чувствительные последовательности белков для анализа массивных наборов данных

.

Нат Биотехнология

.

2017

;

35

(

11

):

1026

8

.74.

Уиллер

TJ

,

Eddy

SR

.

nhmmer: поиск гомологии ДНК с профилем HMMs

.

Биоинформатика

.

2013

;

29

(

19

):

2487

9

,76.

Поле

MA

,

Rosen

BD

,

Dudchenko

O

и др. .

Подтверждающие данные для «Canfam_GSD: De novo сборка генома по длине хромосомы немецкой овчарки ( Canis lupus familis ) с использованием комбинации длинных считываний, оптического картирования и Hi-C.»

.

База данных GigaScience

.

2020

. .

Заметки автора

© Автор (ы) 2020. Опубликовано Oxford University Press.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http://creativecommons. org/licenses/by/4.0/), которая разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии, что оригинал работа правильно процитирована.

Секвенирование генома человека с длинным считыванием и его приложения

  • 1.

    van Dijk, E. L., Jaszczyszyn, Y., Naquin, D. & Thermes, C. Третья революция в технологии секвенирования. Trends Genet. 34 , 666–681 (2018).

    PubMed Google Scholar

  • 2.

    Shendure, J. et al. Секвенирование ДНК в 40 лет: прошлое, настоящее и будущее. Природа 550 , 345–353 (2017).

    CAS Статья Google Scholar

  • 3.

    Sudmant, P.H. et al. Интегрированная карта структурных вариаций в 2 504 геномах человека. Nature 526 , 75–81 (2015).

    CAS PubMed PubMed Central Google Scholar

  • 4.

    Sudmant, P.H. et al. Глобальное разнообразие, стратификация населения и выбор вариации числа копий человека. Наука 349 , aab3761 (2015).

    PubMed PubMed Central Google Scholar

  • 5.

    Ng, S. B. et al. Секвенирование экзома определяет мутации MLL2 как причину синдрома Кабуки. Nat. Genet. 42 , 790–793 (2010).

    CAS PubMed PubMed Central Google Scholar

  • 6.

    Kircher, M. et al. Общая схема оценки относительной патогенности генетических вариантов человека. Nat. Genet. 46 , 310–315 (2014).

    CAS PubMed PubMed Central Google Scholar

  • 7.

    Simonson, T. S. et al. Генетические свидетельства высотной адаптации в Тибете. Science 329 , 72–75 (2010).

    CAS PubMed Google Scholar

  • 8.

    Sudmant, P.H. et al. Разнообразие вариаций числа копий человека и многокопийность генов. Наука 330 , 641–646 (2010).

    CAS PubMed PubMed Central Google Scholar

  • 9.

    Chaisson, M. J. P. et al. Мультиплатформенное открытие структурных вариаций в геномах человека с разрешенными гаплотипами. Nat. Commun. 10 , 1784 (2019). В этом исследовании сравниваются множественные последовательности и технологии картирования для геномов трех троек родитель-ребенок и количественно определяется количество отсутствующих генетических вариаций. Разработан метод Phased-SV, который разделяет долго считываемые данные на основе поэтапных однонуклеотидных полиморфизмов, который разрешает последовательность обоих структурных гаплотипов .

    PubMed PubMed Central Google Scholar

  • 10.

    Консорциум проекта «1000 геномов». и другие. Глобальный справочник по генетической изменчивости человека. Nature 526 , 68–74 (2015).

    Google Scholar

  • 11.

    Бейли, Дж. А., Явор, А. М., Масса, Х. Ф., Траск, Б. Дж. И Эйхлер, Э. Э. Сегментарные дупликации: организация и влияние в рамках текущей сборки проекта генома человека. Genome Res. 11 , 1005–1017 (2001).

    CAS PubMed PubMed Central Google Scholar

  • 12.

    Ходжкинсон А., Чен Ю. и Эйр-Уокер А. Крупномасштабное распределение соматических мутаций в геномах рака. Хум. Мутат. 33 , 136–143 (2012).

    CAS PubMed Google Scholar

  • 13.

    Хиллз, М., Джеяпалан, Дж. Н., Фоксон, Дж. Л. и Ройл, Н. Дж. Механизмы мутации, которые лежат в основе обновления соседнего с теломерами сегментарного дупликации человека, содержащего нестабильный минисателлит. Genomics 89 , 480–489 ​​(2007).

    CAS PubMed Google Scholar

  • 14.

    Гастингс, П. Дж., Лупски, Дж. Р., Розенберг, С. М. и Ира, Г. Механизмы изменения числа копий гена. Nat. Преподобный Жене. 10 , 551–564 (2009).

    CAS PubMed PubMed Central Google Scholar

  • 15.

    Zheng, G. X. Y. et al. Гаплотипирование геномов зародышевой линии и рака с помощью высокопроизводительного секвенирования с последовательным считыванием. Nat. Biotechnol. 34 , 303–311 (2016).

    CAS PubMed PubMed Central Google Scholar

  • 16.

    Zhang, F. et al. Фазирование гаплотипа всего генома человека с использованием разбиения штрих-кода на основе шариков в одной пробирке. Nat. Biotechnol. 35 , 852–857 (2017).

    CAS PubMed Google Scholar

  • 17.

    Wang, O. et al. Эффективное и уникальное кобар-кодирование считываний секвенирования второго поколения с длинных молекул ДНК, обеспечивающее экономичное и точное секвенирование, гаплотипирование и сборку de novo. Genome Res. 29 , 798–808 (2019).

    CAS PubMed PubMed Central Google Scholar

  • 18.

    Li, R. et al. Синтетическое секвенирование с длинным считыванием Illumina позволяет восстановить недостающие последовательности даже в «законченном» геноме C. elegans . Sci. Отчетность 5 , 10814 (2015).

    Google Scholar

  • 19.

    Peters, B.A. et al. Точное секвенирование всего генома и гаплотипирование от 10 до 20 клеток человека. Природа 487 , 190–195 (2012).

    CAS PubMed PubMed Central Google Scholar

  • 20.

    Lieberman-Aiden, E. et al. Комплексное картирование дальнодействующих взаимодействий раскрывает принципы складывания генома человека. Наука 326 , 289–293 (2009).

    CAS PubMed PubMed Central Google Scholar

  • 21.

    Ghurye, J. et al. Интеграция ссылок Hi-C с графами сборки для сборки в масштабе хромосомы. PLoS Comput. Биол. 15 , e1007273 (2019).

    CAS PubMed PubMed Central Google Scholar

  • 22.

    Garg, S. et al. Эффективная сборка геномов человека с разрешением по гаплотипам в масштабе хромосом. Препринт на bioRxiv https://doi.org/10.1101/810341 (2019).

    Артикул Google Scholar

  • 23.

    Harewood, L. et al. Hi-C как инструмент для точного обнаружения и характеристики хромосомных перестроек и вариаций числа копий в опухолях человека. Genome Biol. 18 , 125 (2017).

    PubMed PubMed Central Google Scholar

  • 24.

    Чу, Дж., Мохамади, Х., Уоррен, Р. Л., Янг, К. и Бирол, И. Инновации и проблемы в обнаружении перекрытий при длительном чтении: оценка современного состояния. Биоинформатика 33 , 1261–1270 (2017).

    CAS PubMed Google Scholar

  • 25.

    Юнг, Х., Вайнфилд, К., Бомбарели, А., Прентис, П. и Уотерхаус, П. Инструменты и стратегии для долгого секвенирования и сборки de novo геномов растений. Trends Plant Sci. 24 , 700–724 (2019).

    CAS PubMed Google Scholar

  • 26.

    Седлазек, Ф. Дж., Ли, Х., Дарби, К. А. и Шатц, М. С. Проникновение в темную материю: биоинформатика секвенирования и картирования на больших расстояниях. Nat. Преподобный Жене. 19 , 329–346 (2018).

    CAS PubMed Google Scholar

  • 27.

    Шассон, М.Дж. П., Уилсон, Р. К. и Эйхлер, Е. Е. Генетические вариации и сборка de novo геномов человека. Nat. Преподобный Жене. 16 , 627–640 (2015).

    CAS PubMed PubMed Central Google Scholar

  • 28.

    Поллард, М. О., Гурдасани, Д., Ментцер, А. Дж., Портер, Т. и Сандху, М. С. Лонг читает: их цель и место. Хум. Мол. Genet. 27 , R234 – R241 (2018).

    CAS PubMed PubMed Central Google Scholar

  • 29.

    Мантере Т., Керстен С. и Хойшен А. Долговременное секвенирование, появляющееся в медицинской генетике. Фронт. Genet . 10 , 426 (2019).

  • 30.

    Kronenberg, Z. N. et al. Сравнительный анализ геномов человекообразных обезьян в высоком разрешении. Наука 360 , eaar6343 (2018).

    PubMed PubMed Central Google Scholar

  • 31.

    Audano, P.A. et al. Характеристика основных структурных вариантов аллелей генома человека. Ячейка 176 , 663–675.e19 (2019). В этой статье представлен большой каталог структурных вариантов с разрешенной последовательностью, основанный на анализе последовательностей с длительным считыванием разнообразной панели из 15 геномов, и выявляются случаи, когда человеческий эталон имеет минорный аллель для структурного варианта. Он также разрабатывает основанный на машинном обучении подход к генотипированию структурных вариантов с разрешенной последовательностью в данных последовательности полногеномного ружья Illumina, что привело к открытию локусов количественных признаков экспрессии и новых ведущих вариантов для полногеномных исследований ассоциаций .

    CAS PubMed PubMed Central Google Scholar

  • 32.

    Huddleston, J. et al. Обнаружение и генотипирование структурных вариаций на основе данных длинночитаемых последовательностей гаплоидного генома. Genome Res. 27 , 677–685 (2017).

    CAS PubMed PubMed Central Google Scholar

  • 33.

    Chaisson, M. J. P. et al. Разрешение сложности генома человека с помощью секвенирования одной молекулы. Nature 517 , 608–611 (2015). В этой статье описывается один из первых методов секвенирования и сборки структурных вариаций на основе данных длинночитаемых последовательностей. Это показывает, что большинство этих вариантов являются новыми, и, таким образом, большое количество генетических вариаций человека упускается из-за подходов к короткому считыванию секвенирования.

    CAS PubMed Google Scholar

  • 34.

    Miga, K. H. et al. Сборка теломер-теломер полной Х-хромосомы человека.Препринт на bioRxiv https://doi.org/10.1101/735928 (2019). Это знаменательное исследование показывает, что длинные чтения PacBio и ONT способны генерировать сборку генома de novo, превосходящую по смежности все другие сборки генома (включая hg38). Важно отметить, что это выявляет первую сборку последовательности теломер-теломер хромосомы человека и показывает, что можно разрешить массивы почти идентичных тандемных повторов (то есть центромеры) размером с мегабазу с помощью длинных и сверхдлинных считываний .

    Артикул Google Scholar

  • 35.

    Jain, M. et al. Секвенирование нанопор и сборка генома человека со сверхдлинными считываниями. Nat. Biotechnol. 36 , 338–345 (2018). Эта статья демонстрирует, что сверхдлинные чтения ONT можно использовать для сборки генома человека de novo. Кроме того, эта сборка впервые разрешила оба гаплотипа главного локуса гистосовместимости человека .

    CAS PubMed PubMed Central Google Scholar

  • 36.

    Shafin, K. et al. Секвенирование нанопор и инструментарий Shasta обеспечивают эффективную сборку de novo одиннадцати геномов человека. Nat. Biotechnol. https://doi.org/10.1038/s41587-020-0503-6 (2020). Это исследование описывает быструю сборку 11 геномов человека с использованием длинных чтений ONT, и в нем впервые представлены новые ассемблер (Shasta) и полировщик (HELEN). В этой статье представлена ​​методологическая основа масштабируемости сборки генома человека с использованием длинных считываний .

    Артикул PubMed PubMed Central Google Scholar

  • 37.

    Payne, A., Holmes, N., Rakyan, V. & Loose, M. BulkVis: графический просмотрщик файлов Oxford Nanopore bulk FAST5. Биоинформатика 35 , 2193–2198 (2019).

    CAS PubMed Google Scholar

  • 38.

    Рэнг, Ф. Дж., Клоостерман, У. П. и де Риддер, Дж. От волнистости к базовой паре: вычислительные подходы для повышения точности считывания секвенирования нанопор. Genome Biol. 19 , 90 (2018).

    PubMed PubMed Central Google Scholar

  • 39.

    Ardui, S., Ameur, A., Vermeesch, J. R. & Hestand, M. S. Секвенирование одиночных молекул в реальном времени (SMRT) достигло совершеннолетия: приложения и утилиты для медицинской диагностики. Nucleic Acids Res. 46 , 2159–2168 (2018).

    CAS PubMed PubMed Central Google Scholar

  • 40.

    Карнейро, М.O. et al. Технология секвенирования Pacific Biosciences для генотипирования и обнаружения вариаций в человеческих данных. BMC Genomics 13 , 375 (2012).

    CAS PubMed PubMed Central Google Scholar

  • 41.

    Eid, J. et al. Секвенирование ДНК в реальном времени по отдельным молекулам полимеразы. Наука 323 , 133–138 (2009).

    CAS PubMed Google Scholar

  • 42.

    Корлах, Дж. Понимание точности секвенирования SMRT®. PacBio https://www.pacb.com/wp-content/uploads/2015/09/Perspective_UnderstandingAccuracySMRTSequencing.pdf (2015).

  • 43.

    Роадс, А. и Ау, К. Ф. Секвенирование PacBio и его приложения. Геномика Протеомика Биоинформатика 13 , 278–289 (2015).

    PubMed PubMed Central Google Scholar

  • 44.

    Вейратер, Дж.L. et al. Всестороннее сравнение Pacific Biosciences и Oxford Nanopore Technologies и их приложений для анализа транскриптомов. F1000Res 6 , 100 (2017).

    PubMed PubMed Central Google Scholar

  • 45.

    Фокс, Э. Дж., Рид-Бейлисс, К. С., Эмонд, М. Дж. И Лоеб, Л. А. Точность платформ секвенирования нового поколения. Next Gener. Seq. Прил. 1 , 1000106 (2014).

    PubMed PubMed Central Google Scholar

  • 46.

    Chin, C.-S. и другие. Негибридные, готовые сборки микробного генома из данных секвенирования SMRT с длинным считыванием. Nat. Методы 10 , 563–569 (2013).

    CAS PubMed Google Scholar

  • 47.

    Walker, B.J. et al. Pilon: интегрированный инструмент для комплексного обнаружения вариантов микробов и улучшения сборки генома. PLoS One 9 , e112963 (2014).

    PubMed PubMed Central Google Scholar

  • 48.

    Васер, Р., Сович, И., Нагараджан, Н. и Шикич, М. Быстрая и точная сборка генома de novo из длинных неисправленных считываний. Genome Res. 27 , 737–746 (2017).

    CAS PubMed PubMed Central Google Scholar

  • 49.

    Гарнизон, Э.И Март, Г. Обнаружение вариантов на основе гаплотипов с помощью короткого секвенирования. Препринт на arXiv https://arxiv.org/abs/1207.3907 (2012).

  • 50.

    Gordon, D. et al. Сборка длинночитаемых последовательностей генома гориллы. Наука 352 , aae0344 (2016).

    PubMed PubMed Central Google Scholar

  • 51.

    Ху, Дж., Фан, Дж., Сан, З. и Лю, С. NextPolish: быстрый и эффективный инструмент для полировки генома для сборки длинных считываний. Биоинформатика 36 , 2253–2255 (2020).

    CAS PubMed Google Scholar

  • 52.

    Vollger, M. R. et al. Улучшенная сборка и обнаружение вариантов гаплоидного генома человека с использованием одномолекулярных длинных считываний с высокой точностью. Ann. Гм. Genet. 84 , 125–140 (2020).

    CAS PubMed Google Scholar

  • 53.

    Венгер, А.M. et al. Высокоточное долгосрочное секвенирование улучшает обнаружение вариантов и сборку генома человека. Nat. Biotechnol. 37 , 1155–1162 (2019). Это исследование представляет считывание PacBio HiFi как новый тип данных и показывает возможности высокоточного (более 99%), длинного (более 10 кб) считывания для сборки генома de novo и обнаружения структурных вариантов .

    CAS PubMed PubMed Central Google Scholar

  • 54.

    Vollger, M. R. et al. Долго читаемая последовательность и сборка сегментарных дупликаций. Nat. Методы 16 , 88–94 (2019). В этой статье дается количественная оценка степени, в которой сегментарные дупликации остаются несобранными в геномах с длительным считыванием. Кроме того, в нем описывается метод локального восстановления сегментных дубликатов путем разделения данных длинночитаемой последовательности с использованием графов вариантов паралогичных последовательностей и их локальной сборки .

    CAS PubMed Google Scholar

  • 55.

    Nurk, S. et al. HiCanu: точная сборка сегментных дупликаций и аллельных вариантов из длинных считываний с высокой точностью. Препринт на bioRxiv https://doi.org/10.1101/2020.03.14.9

    (2020).

    Артикул Google Scholar

  • 56.

    Miao, H. et al. Долгосрочное секвенирование выявило причинно-следственный структурный вариант в случае отрицательного экзома и позволило провести преимплантационную генетическую диагностику. Наследие 155 , 32 (2018).

    PubMed PubMed Central Google Scholar

  • 57.

    Вик, Р. Р., Джадд, Л. М. и Холт, К. Э. Производительность инструментов вызова нейронной сети для определения последовательности Oxford Nanopore. Genome Biol. 20 , 129 (2019).

    PubMed PubMed Central Google Scholar

  • 58.

    Li, C. et al. INC-Seq: точное считывание одной молекулы с помощью секвенирования нанопор. Gigascience 5 , 34 (2016).

    CAS PubMed PubMed Central Google Scholar

  • 59. Уилсон, Б. Д., Эйзенштейн, М. & Сох, Х. Т. Высококачественные нанопоры секвенирования ультра-коротких мишени ДНК. Анал. Chem. 91 , 6783–6789 (2019).

    CAS PubMed PubMed Central Google Scholar

  • 60.

    Oxford Nanopore.1D квадратный комплект, доступный в магазине: повышение точности, простая подготовка. Oxford Nanopore Technologies http://nanoporetech.com/about-us/news/1d-squared-kit-available-store-boost-accuracy-simple-prep (2017).

  • 61.

    Lewandowski, K. et al. Метагеномные нанопоры секвенирование вируса гриппа непосредственно от клинических респираторных образцов. J. Clin. Microbiol. 58 , e00963-19 (2019).

    PubMed PubMed Central Google Scholar

  • 62.

    Charalampous, T. et al. Метагеномика нанопор позволяет быстро диагностировать бактериальную инфекцию нижних дыхательных путей. Nat. Biotechnol. 37 , 783–792 (2019).

    CAS PubMed Google Scholar

  • 63.

    Quick, J. et al. Портативное секвенирование генома в реальном времени для эпиднадзора за Эболой. Nature 530 , 228–232 (2016).

    CAS PubMed PubMed Central Google Scholar

  • 64.

    Pendleton, M. et al. Сборка и диплоидная архитектура индивидуального генома человека с помощью одномолекулярных технологий. Nat. Методы 12 , 780–786 (2015).

    CAS PubMed PubMed Central Google Scholar

  • 65.

    Okubo, M. et al. Экспансия повтора GGC NOTCh3NLC у взрослых пациентов с лейкоэнцефалопатией. Ann. Neurol. 86 , 962–968 (2019).

    CAS PubMed Google Scholar

  • 66.

    Sone, J. et al. Секвенирование с длительным считыванием идентифицирует экспансию повторов GGC в NOTCh3NLC, связанную с нейрональным заболеванием внутриядерного включения. Nat. Genet. 51 , 1215–1221 (2019). Авт. Показывают, что PacBio CLR и длинные чтения ONT могут обнаруживать структурные вариации в клинически значимых генах риска заболевания, которые ранее были упущены при коротком считывании всего экзома и полногеномного секвенирования .

    CAS PubMed Google Scholar

  • 67.

    Stefansson, H. et al. Большие рецидивирующие микроделеции, связанные с шизофренией. Nature 455 , 232–236 (2008).

    CAS PubMed PubMed Central Google Scholar

  • 68.

    Sharp, A. J. et al. Обнаружение ранее не идентифицированных геномных нарушений из архитектуры дупликации генома человека. Nat. Genet. 38 , 1038–1042 (2006).

    CAS PubMed Google Scholar

  • 69.

    Hsieh, P. et al. Адаптивная архаичная интрогрессия вариантов числа копий и открытие ранее неизвестных генов человека. Наука 366 , eaax2083 (2019). Авторы описывают большие структурные варианты, происходящие от неандертальцев или денисовцев, которые демонстрируют признаки адаптации и положительного отбора в популяции Меланезии. В частности, они используют длинные чтения для сборки полиморфизма дупликации 386 kb, который присутствует у 79% меланезийцев, но обычно отсутствует в других популяциях, демонстрируя важность разработки новых эталонных геномов человека .

    CAS PubMed PubMed Central Google Scholar

  • 70.

    Shi, L. et al. Долговременное секвенирование и сборка de novo китайского генома. Nat. Commun. 7 , 12065 (2016).

    CAS PubMed PubMed Central Google Scholar

  • 71.

    Seo, J.-S. и другие. De novo Сборка и этапирование корейского генома человека. Nature 538 , 243–247 (2016).

    CAS PubMed Google Scholar

  • 72.

    Международный консорциум проектов генома человека. Начальная последовательность и анализ человеческого генома. Nature 409 , 860–921 (2001).

    Google Scholar

  • 73.

    Koren, S. et al. Canu: масштабируемая и точная сборка с длинным считыванием за счет адаптивного взвешивания k-mer и разделения повторов. Genome Res. 27 , 722–736 (2017).

    CAS PubMed PubMed Central Google Scholar

  • 74.

    Chin, C.-S. & Халак, А. Сборка генома человека за 100 минут. Препринт на bioRxiv https://doi. org/10.1101/705616 (2019). В этой статье описывается уникальный и быстрый алгоритм сборки генома под названием Peregrine, который использует данные PacBio HiFi. Этот долго читаемый ассемблер способен собрать человеческий геном менее чем за 100 минут или ~ 30 процессорных часов .

    Артикул Google Scholar

  • 75.

    Chin, C.-S. и другие. Поэтапная диплоидная сборка генома с секвенированием одной молекулы в реальном времени. Nat. Методы 13 , 1050–1054 (2016).

    CAS PubMed PubMed Central Google Scholar

  • 76.

    Колмогоров М., Юань Дж., Лин Ю. и Певзнер П. А. Сборка длинных, подверженных ошибкам операций чтения с использованием графов повторений. Nat. Biotechnol. 37 , 540–546 (2019).

    CAS PubMed Google Scholar

  • 77.

    Ruan, J. & Li, H. Быстрая и точная сборка с долгим чтением с wtdbg2. Nat. Методы 17 , 155–158 (2020).

    CAS PubMed Google Scholar

  • 78.

    Steinberg, K. M. et al. Качественная сборка индивида йорубанского происхождения.Препринт на bioRxiv https://doi.org/10.1101/067447 (2016).

    Артикул Google Scholar

  • 79.

    Oliver, J. S. et al. Электронные карты генома высокого разрешения на основе данных отдельных молекул. Препринт на bioRxiv https://doi.org/10.1101/139840 (2017).

    Артикул Google Scholar

  • 80.

    Удалл, Дж. А. и Доу, Р. К. Правильно ли заказано? Проверка сборки генома с помощью оптического картирования. Растительная клетка 30 , 7–14 (2018).

    CAS PubMed Google Scholar

  • 81.

    Ameur, A. et al. Сборка de novo двух шведских геномов выявляет недостающие сегменты из эталона GRCh48 человека и улучшает вызов вариантов данных секвенирования в масштабе популяции. Гены 9 , 486 (2018).

    PubMed Central Google Scholar

  • 82.

    Li, H. Выравнивающие последовательности считывания, последовательности клонирования и контиги сборки с BWA-MEM. Препринт на arXiv https://arxiv.org/abs/1303.3997 (2013).

  • 83.

    Уотсон, М. и Уорр, А. Ошибки в сборках с длительным считыванием могут критически повлиять на предсказание белка. Nat. Biotechnol. 37 , 124–126 (2019).

    CAS PubMed Google Scholar

  • 84

    Корен, С., Филлиппи, А. М., Симпсон, Дж. Т., Ломан, Н. Дж. И Луз, М. Ответ на «Ошибки в сборках для длительного чтения могут критически повлиять на предсказание белка». Nat. Biotechnol. 37 , 127–128 (2019).

    CAS PubMed Google Scholar

  • 85.

    Loman, N.J., Quick, J. & Simpson, J. T. Собран полный бактериальный геном de novo с использованием только данных секвенирования нанопор. Nat. Методы 12 , 733–735 (2015).

    CAS PubMed Google Scholar

  • 86.

    Simpson, J. T. et al. Обнаружение метилирования цитозина ДНК с помощью секвенирования нанопор. Nat. Методы 14 , 407–410 (2017). Авторы сообщают о методе обнаружения метилированных цитозинов в необработанных чтениях ONT на основе характерных нарушений сигнала в данных ONT с использованием вычислительного инструмента Nanopolish. Этот инструмент используется для картирования метилирования в пределах центромеры .

    CAS PubMed Google Scholar

  • 87.

    Koren, S. et al. De novo сборка геномов с разрешенными гаплотипами с помощью трио биннинга. Nat. Biotechnol. 36 , 1174–1182 (2018). Авт. Демонстрируют метод фазирования гаплотипов для сборки генома de novo, известный как trio binning, в котором чтения от родителей используются для идентификации и разделения чтения от ребенка на гаплотипы перед сборкой последовательности .

    CAS Google Scholar

  • 88.

    Porubský, D. et al. Прямое гаплотипирование по длине хромосомы путем секвенирования одной клетки. Genome Res. 26 , 1565–1574 (2016).

    PubMed PubMed Central Google Scholar

  • 89.

    Patterson, M. et al. WhatsHap: взвешенная сборка гаплотипов для чтения секвенирования будущего поколения. J. Computational Biol. 22 , 498–509 (2015).

    CAS Google Scholar

  • 90.

    Kronenberg, Z. N. et al. Расширенное фазирование гаплотипов сборок генома de novo с помощью FALCON-Phase. Препринт на bioRxiv https://doi.org/10.1101/327064 (2019).

    Артикул Google Scholar

  • 91.

    Порубский Д. и др. Полностью поэтапная точная сборка индивидуального генома человека.Препринт на bioRxiv https://doi.org/10.1101/855049 (2019).

    Артикул Google Scholar

  • 92.

    Eichler, E. E. Недавняя дупликация, наращивание домена и динамическая мутация генома человека. Trends Genet. 17 , 661–669 (2001).

    CAS PubMed Google Scholar

  • 93.

    Родригес, О. Л., Ритц, А., Шарп, А. Дж.И Башир, А. MsPAC: инструмент для определения структурных вариантов по гаплотипам. Биоинформатика 36 , 922–924 (2019).

    PubMed Central Google Scholar

  • 94.

    Бзикадзе, А.В. и Певзнер, П.А. centroFlye: сборка центромер с длинными подверженными ошибкам чтениями. Препринт на bioRxiv https://doi.org/10.1101/772103 (2019).

    Артикул Google Scholar

  • 95.

    Ebbert, M. T. W. et al. Систематический анализ темных и замаскированных генов выявляет гены, связанные с заболеванием, которые прячутся на виду. Genome Biol. 20 , 97 (2019).

    PubMed PubMed Central Google Scholar

  • 96.

    Feng, Z. et al. Обнаружение модификаций ДНК из данных секвенирования SMRT путем моделирования зависимости кинетики полимеразы от контекста последовательности. PLoS Comput. Биол. 9 , e1002935 (2013).

    CAS PubMed PubMed Central Google Scholar

  • 97.

    Sedlazeck, F. J. et al. Точное обнаружение сложных структурных изменений с помощью секвенирования отдельных молекул. Nat. Методы 15 , 461–468 (2018).

    CAS PubMed PubMed Central Google Scholar

  • 98.

    Chaisson, M. J. & Tesler, G. Отображение последовательностей считываний отдельных молекул с использованием базового локального выравнивания с последовательным уточнением (BLASR): применение и теория. BMC Bioinformatics 13 , 238 (2012).

    CAS PubMed PubMed Central Google Scholar

  • 99.

    Li, H. Minimap2: попарное выравнивание нуклеотидных последовательностей. Биоинформатика 34 , 3094–3100 (2018).

    CAS PubMed PubMed Central Google Scholar

  • 100.

    Berlin, K. et al. Сборка больших геномов с помощью секвенирования одной молекулы и хеширования с учетом местоположения. Nat. Biotechnol. 33 , 623–630 (2015).

    CAS PubMed Google Scholar

  • 101.

    Mizuguchi, T. et al. Структурная вариация размером 12 т.п.н. при прогрессирующей миоклонической эпилепсии была недавно идентифицирована с помощью долгого считывания полногеномного секвенирования. J. Hum. Genet. 64 , 359–368 (2019).

    CAS PubMed Google Scholar

  • 102.

    Merker, J. D. et al. Долгосрочное секвенирование генома определяет причинно-следственные структурные вариации менделевской болезни. Genet. Med. 20 , 159–163 (2018).

    CAS PubMed Google Scholar

  • 103.

    Zeng, S. et al. Длительное секвенирование выявило интронные расширения повторов в SAMD12 из китайских родословных, пораженных семейным кортикальным миоклоническим тремором с эпилепсией. J. Med. Genet. 56 , 265–270 (2019).

    CAS PubMed Google Scholar

  • 104.

    Reiner, J. et al. Цитогеномная идентификация и долгосрочное секвенирование одиночной молекулы в режиме реального времени (SMRT) делеции синдрома Барде-Бидла 9 (BBS9). NPJ Genom. Med. 3 , 3 (2018).

    PubMed PubMed Central Google Scholar

  • 105.

    Sato, N. et al. Спиноцеребеллярная атаксия 31 типа связана со «вставленными» пента-нуклеотидными повторами, содержащими (TGGAA) n. Am. J. Hum. Genet. 85 , 544–557 (2009).

    CAS PubMed PubMed Central Google Scholar

  • 106.

    Dutta, U. R. et al. Картирование точек останова новой транслокации de novo t (X; 20) (q11.1; p13) путем позиционного клонирования и секвенирования при долгом чтении. Genomics 111 , 1108–1114 (2019).

    CAS PubMed Google Scholar

  • 107.

    de Jong, L.C. et al. Секвенирование с помощью нанопор полноразмерных транскриптов мРНК BRCA1 выявляет совместное возникновение известных событий пропуска экзонов. Breast Cancer Res. 19 , 127 (2017).

    PubMed PubMed Central Google Scholar

  • 108.

    Wenzel, A. et al. Секвенирование одной молекулы в реальном времени в ADTKD-MUC1 позволяет полностью собрать VNTR и точно определить причинные мутации. Sci. Rep. 8 , 4170 (2018).

    PubMed PubMed Central Google Scholar

  • 109.

    Ishiura, H. et al. Расширения некодирующих CGG-повторов при нейрональной болезни внутриядерного включения, окулофарингодистальной миопатии и перекрывающемся заболевании. Nat. Genet. 51 , 1222–1232 (2019).

    CAS PubMed Google Scholar

  • 110.

    Анейчик, Т.и другие. Рассмотрение причинного механизма Х-сцепленной дистонии-паркинсонизма путем интеграции сборки генома и транскриптома. Ячейка 172 , 897–909.e21 (2018).

    CAS PubMed PubMed Central Google Scholar

  • 111.

    Сонг, Дж. Х. Т., Лоу, К. Б. и Кингсли, Д. М. Характеристика специфичного для человека тандемного повтора, связанного с биполярным расстройством и шизофренией. Am. J. Hum. Genet. 103 , 421–430 (2018).

    CAS PubMed PubMed Central Google Scholar

  • 112.

    Carvalho, C.M.B. et al. Переключение межхромосомных матриц как новый молекулярный механизм импринтинга нарушений, связанных с синдромом Темпла. Genome Med. 11 , 25 (2019).

    PubMed PubMed Central Google Scholar

  • 113.

    Giesselmann, P. et al.Анализ расширений коротких тандемных повторов и их состояния метилирования с помощью секвенирования нанопор. Nat. Biotechnol. 37 , 1478–1481 (2019).

    CAS PubMed Google Scholar

  • 114.

    Sulovari, A. et al. Расширение тандемных повторов, специфичных для человека, и дифференциальная экспрессия генов во время эволюции приматов. Proc. Natl Acad. Sci. США 116 , 23243–23253 (2019).

    CAS PubMed Google Scholar

  • 115.

    Lei, X. X. et al. Экспансия повторов TTTCA вызывает семейный корковый миоклонический тремор с эпилепсией. Eur. J. Neurol. 26 , 513–518 (2019).

    CAS PubMed Google Scholar

  • 116.

    Fiddes, I. T. et al. Специфичные для человека гены NOTCh3NL влияют на передачу сигналов Notch и корковый нейрогенез. Ячейка 173 , 1356–1369.e22 (2018).

    CAS PubMed PubMed Central Google Scholar

  • 117.

    Suzuki, I. K. et al. Специфичные для человека гены NOTCh3NL расширяют корковый нейрогенез за счет регуляции Delta / Notch. Ячейка 173 , 1370–1384.e16 (2018).

    CAS PubMed PubMed Central Google Scholar

  • 118.

    Mefford, H.C. et al. Рекуррентные перестройки хромосомы 1q21.1 и вариабельные педиатрические фенотипы. N. Engl. J. Med. 359 , 1685–1699 (2008).

    CAS PubMed PubMed Central Google Scholar

  • 119.

    Brunetti-Pierri, N. et al. Рецидивирующие реципрокные делеции и дупликации 1q21.1, связанные с микроцефалией или макроцефалией, а также аномалиями развития и поведения. Nat. Genet. 40 , 1466–1471 (2008).

    CAS PubMed PubMed Central Google Scholar

  • 120.

    He, Y. et al. Долговременная сборка генома китайского макака-резуса и идентификация структурных вариантов, специфичных для обезьян. Nat. Commun. 10 , 4233 (2019).

    PubMed PubMed Central Google Scholar

  • 121.

    Национальный исследовательский институт генома человека. NHGRI финансирует центры по продвижению эталонной последовательности генома человека. Genome.gov https://www.genome.gov/news/news-release/NIH-funds-centers-for-advancing-sequence-of-human-genome-reference (2019).

  • 122.

    Garalde, D. R. et al.Высоко параллельное прямое секвенирование РНК на массиве нанопор. Nat. Методы 15 , 201–206 (2018). Авторы описывают метод секвенирования полноразмерных молекул нативной РНК с технологиями секвенирования ONT, упрощая процесс, удаляя этапы преобразования РНК в кДНК перед секвенированием .

    CAS PubMed Google Scholar

  • 123.

    Workman, R.E. et al. Секвенирование нативной РНК нанопор поли (А) транскриптома человека. Nat. Методы 16 , 1297–1305 (2019).

    CAS PubMed PubMed Central Google Scholar

  • 124.

    Soneson, C. et al. Комплексное исследование секвенирования нативной РНК Nanopore для характеристики сложных транскриптомов. Nat. Commun. 10 , 3359 (2019).

    PubMed PubMed Central Google Scholar

  • 125.

    Flusberg, B.A. et al. Прямое обнаружение метилирования ДНК во время секвенирования одной молекулы в реальном времени. Nat. Методы 7 , 461–465 (2010).

    CAS PubMed PubMed Central Google Scholar

  • 126.

    Vilfan, I. D. et al. Анализ модификации оснований РНК и структурных перестроек с помощью одномолекулярного обнаружения обратной транскрипции в реальном времени. J. Nanobiotechnol. 11 , 8 (2013).

    CAS Google Scholar

  • 127.

    Rand, A.C. et al. Картирование метилирования ДНК с помощью высокопроизводительного секвенирования нанопор. Nat. Методы 14 , 411–413 (2017).

    CAS PubMed PubMed Central Google Scholar

  • 128.

    Шарон, Д., Тилгнер, Х., Груберт, Ф. и Снайдер, М. Одномолекулярный долгосрочный обзор человеческого транскриптома. Nat. Biotechnol. 31 , 1009–1014 (2013).

    CAS PubMed PubMed Central Google Scholar

  • 129.

    Au, K. F. et al. Характеристика транскриптома ESC человека с помощью гибридного секвенирования. Proc. Natl Acad. Sci. США 110 , E4821 – E4830 (2013). В этой статье показано, что транскрипты мРНК полной длины можно секвенировать от конца до конца для идентификации новых изоформ генов с использованием метода PacBio Iso-Seq.В этой статье также представлен каталог поли (A) транскриптома в человеческих эмбриональных стволовых клетках с использованием комбинации Iso-Seq и данных короткого чтения .

    CAS PubMed Google Scholar

  • 130.

    Byrne, A. et al. RNAseq с длинным считыванием нанопор обнаруживает широко распространенные транскрипционные вариации среди поверхностных рецепторов индивидуальных В-клеток. Nat. Commun. 8 , 16027 (2017).

    CAS PubMed PubMed Central Google Scholar

  • 131.

    Oikonomopoulos, S., Wang, Y.C, Djambazian, H., Badescu, D. & Ragoussis, J. Сравнительный анализ секвенирования Oxford Nanopore MinION для количественной и качественной оценки популяций кДНК. Sci. Отчет 6 , 31602 (2016).

    CAS PubMed PubMed Central Google Scholar

  • 132.

    Dougherty, M. L. et al. Транскрипционные судьбы специфичных для человека сегментарных дупликаций в головном мозге. Genome Res. 28 , 1566–1576 (2018).

    CAS PubMed PubMed Central Google Scholar

  • 133.

    Volden, R. et al. Повышение точности считывания нанопор с помощью метода R2C2 позволяет секвенировать высоко мультиплексированные полноразмерные одноклеточные кДНК. Proc. Natl Acad. Sci. США 115 , 9726–9731 (2018).

    CAS PubMed Google Scholar

  • 134.

    Aird, D. et al. Анализ и минимизация систематической ошибки амплификации ПЦР в библиотеках секвенирования Illumina. Genome Biol. 12 , R18 (2011).

    CAS PubMed PubMed Central Google Scholar

  • 135.

    Clark, M. B. et al. Долговременное секвенирование показывает сложный профиль сплайсинга гена психиатрического риска CACNA1C в человеческом мозге. Mol Psychiatry 25 , 37–47 (2020).

    CAS PubMed Google Scholar

  • 136.

    Tang, A. D. et al. Характеристика полноразмерного транскрипта мутации SF3B1 при хроническом лимфолейкозе выявляет подавление сохраняемых интронов. Nat. Commun. 11 , 1438 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 137.

    Clark, T. A. et al. Определение специфичности ДНК-метилтрансферазы с использованием одномолекулярного секвенирования ДНК в реальном времени. Nucleic Acids Res. 40 , e29 (2012).

    CAS PubMed Google Scholar

  • 138.

    Huang, Y. et al. Поведение 5-гидроксиметилцитозина при бисульфитном секвенировании. PLoS One 5 , e8888 (2010).

    PubMed PubMed Central Google Scholar

  • 139.

    Pacific Biosciences. Обнаружение модификаций оснований ДНК с использованием отдельной молекулы, секвенирование в реальном времени. PacBio https://www.pacb.com/wp-content/uploads/2015/09/WP_Detecting_DNA_Base_Modifications_Using_SMRT_Sequencing.pdf (2015).

  • 140.

    Frommer, M. et al. Протокол геномного секвенирования, который дает положительное отображение остатков 5-метилцитозина в отдельных цепях ДНК. Proc. Natl Acad. Sci. США 89 , 1827–1831 (1992).

    CAS PubMed Google Scholar

  • 141.

    Ан, Н., Флеминг, А. М., Уайт, Х. С. и Берроуз, С. Дж. Обнаружение нанопор 8-оксогуанина в последовательности повторов теломер человека. САУ Нано 9 , 4296–4307 (2015).

    CAS PubMed PubMed Central Google Scholar

  • 142.

    Liu, H. et al. Точное обнаружение модификаций m 6 A РНК в последовательностях нативной РНК. Nat. Commun. 10 , 4079 (2019).

    PubMed PubMed Central Google Scholar

  • 143.

    Leger, A. et al. Обнаружение модификаций РНК с помощью сравнительного прямого секвенирования РНК Nanopore. Препринт на bioRxiv https://doi.org/10.1101/843136 (2019).

    Артикул Google Scholar

  • 144.

    Lorenz, D. A., Sathe, S., Einstein, J. M. & Yeo, G. W. Прямое секвенирование РНК позволяет обнаруживать m 6 A в изоформах эндогенных транскриптов с разрешением по основанию. РНК https://doi.org/10.1261/rna.072785.119 (2019).

    Артикул PubMed Google Scholar

  • 145.

    Li, Y. & Tollefsbol, T. O. Обнаружение метилирования ДНК: бисульфитный анализ геномного секвенирования. Methods Mol. Биол. 791 , 11–21 (2011).

    CAS PubMed PubMed Central Google Scholar

  • 146.

    Шефер М., Поллекс Т., Ханна К. и Лико Ф. Анализ метилирования цитозина РНК с помощью бисульфитного секвенирования. Nucleic Acids Res. 37 , e12 (2009).

    PubMed Google Scholar

  • 147.

    Levanon, E. Y. et al. Систематическая идентификация множества сайтов редактирования A-to-I в человеческом транскриптоме. Nat. Biotechnol. 22 , 1001–1005 (2004).

    CAS PubMed Google Scholar

  • 148.

    Incarnato, D. et al. Высокопроизводительное картирование с разрешением одного основания 2΄-O-метилированных остатков РНК. Nucleic Acids Res. 45 , 1433–1441 (2017).

    CAS PubMed Google Scholar

  • 149.

    Бакин А. В. и Офенганд Дж. Картирование остатков псевдоуридина в РНК для разрешения нуклеотидов. Methods Mol. Биол. 77 , 297–309 (1998).

    CAS PubMed Google Scholar

  • 150.

    Цай, Ю.-К. и другие. Без амплификации, целевое обогащение CRISPR-Cas9 и SMRT-секвенирование геномных областей, вызывающих болезнь, вызывающую повторную экспансию.Препринт на bioRxiv https://doi.org/10.1101/203919 (2017).

    Артикул Google Scholar

  • 151.

    Hafford-Tear, N.J. et al. CRISPR / Cas9-целевое обогащение и долгосрочное секвенирование триплетного повтора TCF4, связанного с эндотелиальной дистрофией роговицы Fuchs. Genet. Med. 21 , 2092–2102 (2019).

    PubMed PubMed Central Google Scholar

  • 152.

    Suzuki, Y. et al. AgIn: измерение ландшафта метилирования CpG отдельных повторяющихся элементов. Биоинформатика 32 , 2911–2919 (2016).

    CAS PubMed PubMed Central Google Scholar

  • 153.

    Ni, P. et al. DeepSignal: обнаружение состояния метилирования ДНК из считывания секвенирования нанопор с использованием глубокого обучения. Биоинформатика 35 , 4586–4595 (2019).

    CAS PubMed Google Scholar

  • 154.

    Макинтайр, А. Б. Р. и др. Определение N6-метиладенина с помощью секвенирования одной молекулы в эталонных микробных материалах. Nat. Commun. 10 , 579 (2019).

    CAS PubMed PubMed Central Google Scholar

  • 155.

    Liu, Q. et al. Обнаружение модификаций оснований ДНК глубокой рекуррентной нейронной сетью по данным секвенирования Oxford Nanopore. Nat. Commun. 10 , 2449 (2019).

    PubMed PubMed Central Google Scholar

  • 156.

    Stoiber, M. et al. Идентификация de novo модификаций ДНК благодаря обработке сигналов нанопор, управляемой геномом. Препринт на bioRxiv https://doi.org/10.1101/0

    (2017).

    Артикул Google Scholar

  • 157.

    Lee, I. et al. Одновременное профилирование доступности и метилирования хроматина на линиях клеток человека с секвенированием нанопор. Препринт на bioRxiv https://doi.org/10.1101/504993 (2019).

    Артикул Google Scholar

  • 158.

    Beyter, D. et al. Длительное секвенирование 1817 исландцев дает представление о роли структурных вариантов в заболеваниях человека. Препринт на bioRxiv https://doi.org/10.1101/848366 (2019).

    Артикул Google Scholar

  • 159.

    Garrison, E. et al. Набор инструментов графа вариаций улучшает отображение считываемых данных, представляя генетические вариации в ссылке. Nat. Biotechnol. 36 , 875–879 (2018).

    CAS PubMed PubMed Central Google Scholar

  • 160.

    Schneider, V.A. et al. Оценка сборок гаплоидных геномов GRCh48 и de novo демонстрирует неизменное качество эталонной сборки. Genome Res. 27 , 849–864 (2017).

    CAS PubMed PubMed Central Google Scholar

  • 161.

    Li, R. et al. Построение карты последовательностей пангенома человека. Nat. Biotechnol. 28 , 57–63 (2010).

    CAS PubMed Google Scholar

  • 162.

    Gnerre, S. et al. Высококачественные черновые сборки геномов млекопитающих из массивно параллельных данных последовательностей. Proc. Natl Acad. Sci. США 108 , 1513–1518 (2011).

    CAS PubMed Google Scholar

  • 163.

    Sanders, A. D., Falconer, E., Hills, M., Spierings, D. C. J. & Lansdorp, P. M. Одноклеточное матричное секвенирование цепи с помощью Strand-seq позволяет характеризовать отдельные гомологи. Nat. Protoc. 12 , 1151–1176 (2017).

    CAS PubMed Google Scholar

  • 164.

    Sanders, A. D. et al. Одноячеечный анализ структурных вариаций и сложных перестроек с трехканальной обработкой. Nat. Biotechnol. 38 , 343–354 (2020).

    CAS PubMed Google Scholar

  • 165.

    Порубский Д. и др. Плотное и точное гаплотипирование отдельных геномов по всей хромосоме. Nat. Commun. 8 , 1293 (2017).

    PubMed PubMed Central Google Scholar

  • 166.

    Wu, J. K et al. Синдром тромбоцитопении-отсутствующей лучевой кости: история вопроса, патофизиология, эпидемиология. Medscape https://reference.medscape.com/article/2-overview (2019).

  • 167.

    Rosenfeld, J. A. et al. Проксимальные микроделеции и микродупликации 1q21.1 вносят вклад в различные аномальные фенотипы. Eur. J. Hum. Genet. 20 , 754–761 (2012).

    CAS PubMed PubMed Central Google Scholar

  • Измерения кинетики самосборки отдельных вирусных капсидов вокруг их РНК-генома

    Значение

    Самосборка — это процесс, в котором функциональные наноразмерные структуры строятся сами по себе, движимые броуновским движением и взаимодействиями между компонентами. Первоначально этот термин был придуман для описания образования вирусного капсида, белковой оболочки, которая защищает геном вируса. Несмотря на десятилетия исследований, самосборка капсидов оставалась загадкой, поскольку не существовало методов измерения кинетики сборки отдельных капсидов. Мы преодолеваем это препятствие, используя метод чувствительной микроскопии, основанный на лазерной интерферометрии. Измерения показывают, что небольшое ядро ​​белков должно сформироваться на вирусной РНК до того, как соберется капсид. Эти результаты могут помочь исследователям разработать стратегии, чтобы остановить сборку патогенных вирусов или построить синтетические наноструктуры.

    Abstract

    Самосборка широко используется биологическими системами для создания функциональных наноструктур, таких как белковые капсиды РНК-вирусов. Но поскольку сборка является коллективным явлением, включающим множество слабо взаимодействующих субъединиц и широкий диапазон временных масштабов, измерения путей сборки были труднодостижимыми. Мы используем микроскопию интерферометрического рассеяния для измерения кинетики сборки отдельных капсидов бактериофага MS2 вокруг РНК MS2. Регистрируя, сколько белков оболочки связывается с каждой из многих отдельных цепей РНК, мы обнаруживаем, что сборка происходит путем нуклеации с последующим монотонным ростом.Наши измерения выявляют пути сборки в количественных деталях, а также показывают их виды отказов. Мы используем эти результаты для критического изучения моделей процесса сборки.

    Термин «самосборка» (1) первоначально был придуман для описания образования вирусного капсида, упорядоченной оболочки белков оболочки, окружающей вирусный геном. Капсиды многих РНК-вирусов могут спонтанно образовываться in vitro из составляющих белков оболочки и цепей РНК (2) в отсутствие гидролиза АТФ или других факторов клетки-хозяина.Эти результаты предполагают, что полный, правильно сформированный капсид представляет собой минимум свободной энергии.

    Минимизация свободной энергии объясняет, почему, но не как собираются определенные структуры капсида. Поскольку сборка является стохастической, есть много причин, по которым этот процесс может пойти наперекосяк (3). Чтобы сформировать капсид на фиг. 1 A , который имеет число триангуляции T, равное 3 (1), 90 химически идентичных димеров белка оболочки должны располагаться в симметрично различных наборах положений. Несмотря на эту структурную сложность, собственные капсиды с Т = 3 собираются с высоким выходом вокруг РНК в соответствующих условиях in vitro (4).Более того, деформированные капсиды, которые образуются в субоптимальных условиях (5), представляют собой лишь крошечное подмножество всех возможных неправильно собранных структур. Недавние теоретические модели предполагают, что взаимодействия между собирающими белками (6) или между белками и РНК (7) смещают пути сборки в сторону правильных капсидов и от неправильно собранных структур.

    Рис. 1.

    Обзор измерения. ( A ) Структурная модель капсида MS2 (PDB ID: 2ms2) показывает его небольшой размер и структуру T = 3.Две конфигурации димера белка оболочки показаны серым и пурпурным. ( B ) Мы вводим раствор несобранных димеров поверх покровного стекла, на котором цепи РНК MS2 связаны связями ДНК. Когда димеры связываются с РНК, полученные частицы рассеивают свет. Частицы выглядят как темные пятна с ограничением дифракции из-за деструктивной интерференции между рассеянным светом и опорным лучом. ( C ) Мы отслеживаем множество таких точек параллельно. Показано типичное изображение поля зрения, снятое через 126 с после добавления 2-мкм димеров и представляющее в среднем 1000 кадров, снятых со скоростью 1000 кадров в секунду.( D ) Интенсивность каждого пятна пропорциональна количеству связанных белков в каждой частице, и изменения интенсивности как функция времени показывают кинетику сборки каждой частицы. Чем темнее пятно, тем больше его интенсивность. ( D , Top ) Временные ряды изображений для прямоугольной области в C . ( D , Bottom ) График интенсивности для того же пятна с использованием среднего значения за 1000 кадров. Мы обсуждаем взаимосвязь между интенсивностью и количеством связанных белков, а также то, как мы вычисляем интенсивность пятна, в Материалах и методах и SI Приложение .

    Однако эксперименты еще не дали ответа даже на основные вопросы о путях сборки и роли РНК, например, начинается ли сборка с небольшого кластера РНК-связанных белков или происходит из большого, неупорядоченного агрегата белков и РНК ( 8). Прямые измерения сборки вируса являются сложной задачей, поскольку взаимодействия между субъединицами обычно слабые и зависят от условий раствора (9), так что шкалы времени сборки могут охватывать многие порядки величины: от менее 1 с для начального связывания белков с белками. РНК (10) до многих минут (11) или даже часов (12) для полной сборки ансамбля капсидов.Структурные методы (13) не имеют достаточного временного разрешения для наблюдения за сборкой в ​​таком широком диапазоне временных масштабов, а объемные кинетические измерения (14), которые имеют необходимый динамический диапазон, усредняются по частицам в возможно различных состояниях сборки. Определение оперативных путей требует измерения кинетики сборки отдельных капсидов вокруг вирусной РНК.

    Результаты

    Для проведения таких измерений мы используем интерферометрическую микроскопию рассеяния (15).Мы привязываем РНК-геном бактериофага MS2 — вируса с одноцепочечной РНК с положительным смыслом T = 3, который инфицирует бактерий Escherichia coli — к поверхности функционализированного покровного стекла с помощью связей ДНК (16) (рис. 1 B ). Затем мы вводим несобранные димеры белка оболочки MS2, суспендированные в буфере с физиологическим pH и соленостью, и мы измеряем изменения в интенсивности рассеяния, когда димеры прикрепляются к поверхностно-привязанной РНК (рис. 1 B и C ). Каждая из этих кривых интенсивности показывает, как количество димеров белка оболочки, связанных с отдельной цепью РНК, изменяется со временем, показывая кинетику сборки этой частицы (рис. 1 D ).

    Динамический диапазон этого измерения велик: поскольку рассеяние является упругим, мы можем использовать высокую интенсивность освещения с минимальным риском фотоповреждения, обеспечивая временное разрешение 1 мс. Чтобы одновременно достичь длительности 900 с, мы активно стабилизируем микроскоп во всех трех измерениях, гарантируя, что сигнал от собираемого капсида больше, чем шум из-за дрейфа. Тогда чувствительность ограничивается дробовым шумом. При скользящей средней длительностью 1 с, как показано на рис.1 D , размах колебаний дробового шума соответствует интенсивности 6 димеров белка оболочки.

    Поскольку мы получаем кривые интенсивности для многих собирающихся параллельно частиц, измерение информирует нас о кинетике сборки отдельных частиц, а также о кинетике ансамбля. Ансамбль характеризуется следами, которые сохраняются при низкой интенсивности, затем быстро нарастают, а затем выходят на плато при более высокой интенсивности (Рис.2 A и SI Приложение , Рис.S1). Когда мы вводим 2 мкМ димеры белка оболочки, мы обнаруживаем, что большинство следов (около 85%) плато с конечной интенсивностью, соответствующей или немного меньшей, чем у полного капсида дикого типа ( SI Приложение , рис. S2), а остальные выходят на плато при значительно более высоких интенсивностях. Напротив, в отсутствие РНК следов мало, и они медленно и непрерывно увеличиваются на протяжении всего эксперимента ( SI Приложение , рис. S3).

    Рис. 2.

    Сборка 2-мкМ димеров белка оболочки вокруг цепей РНК, связанных с поверхностью.( A ) Трассы интенсивности для 12 случайно выбранных частиц из одного эксперимента. Отметки оси x показывают время начала, а отметки оси y — конечную интенсивность. Серая полоса указывает диапазон интенсивности, соответствующий капсидам дикого типа. Стрелками показаны 2 следа, соответствующие заросшим частицам. ( B ) Отрицательно окрашенное ПЭМ-изображение частиц, собранных вокруг цепей РНК, привязанных к золотой наночастице (темная область в центре). Мы используем наночастицы в качестве подложки, потому что ПЭМ не может получать изображения через покровное стекло.( C ) Кумулятивное распределение времени начала всех трасс в эксперименте хорошо согласуется с экспонентой со временем задержки t0, равным 92 с, и характерным временем τ, равным 84 с (см. SI Приложение для результатов подбора повторные эксперименты). Погрешности времени начала меньше диаметра окружностей.

    В отдельном контрольном эксперименте мы использовали просвечивающую электронную микроскопию (ПЭМ) для изображения структур, которые собираются вокруг связанной с поверхностью РНК.Изображения показывают, что большинство собранных структур являются собственными капсидами, с несколькими видимыми частичными капсидами и более крупными структурами (Рис. 2 B и SI Приложение , Рис. S4). Таким образом, мы делаем вывод, что капсиды действительно могут собираться вокруг связанных цепей РНК и что следы, которые достигают интенсивности, аналогичной таковой у капсидов дикого типа, представляют собой образование полных или почти полных капсидов.

    Понимая это, мы исследуем, что различия между отдельными следами говорят о путях сборки.Ключевое наблюдение заключается в том, что сборка не синхронна: «время начала», время, в которое интенсивность быстро увеличивается, варьируется от частицы к частице (Рис. 2 A и SI Приложение , Рис. S1). Мы обнаружили, что кумулятивное распределение времени начала t хорошо аппроксимируется экспоненциальной функцией A1 − exp− (t − t0) / τ (рис. 2 C ), где A — значение плато, t0 — задержка до время старта первой частицы, τ — характерное время. Значения и неопределенности параметров подгонки, оцененные на основе подгонок к повторным измерениям, составляют A = 57 ± 7, t0 = 60 ± 20 с и τ = 100 ± 20 с (стандартное отклонение) ( SI Приложение , рис.S5).

    Задержка t0 перед первым временем старта, вероятно, является результатом диффузии и порогового значения концентрации для сборки. Мы знаем, что такой порог существует, потому что мы не видим сборки, когда вводим 1 мкМ димеры белка оболочки ( SI Приложение , рис. S6). Поэтому мы ожидаем, что сборка будет отложена до тех пор, пока концентрация димера на поверхности покровного стекла не достигнет порогового значения. Поскольку порог составляет от 1 до 2 мкМ, мы можем оценить t0 по характерному времени диффузии димеров из 2 мкМ закачанной жидкости на поверхность.Наша оценка от 30 до 55 с ( SI Приложение , рис. S7) близка к наблюдаемому t0, равному 60 ± 20 с.

    Однако такое широкое распределение времени начала не является результатом распространения. Мы могли бы ожидать роста, ограниченного диффузией, только в том случае, если бы концентрация белка вокруг каждой РНК варьировалась в поле зрения 10 мкм. Но время для диффузии димера 10 мкм составляет всего 1 с, что намного меньше ширины распределения. Кроме того, после начальной задержки, по нашим оценкам, около 1000 димеров белка оболочки находятся в пределах 1 мкм от каждой РНК.При этой концентрации пул белков оболочки существенно не истощается при сборке, и колебания концентрации незначительны. Мы пришли к выводу, что наблюдаемые следы интенсивности не являются результатом изменений концентрации белка.

    Взятые вместе, эти результаты исключают пути сборки, которые начинаются с агрегации, ограниченной диффузией, и четко указывают на те, которые включают зародышеобразование — процесс, в котором первоначально нестабильный кластер белков, называемый «ядром», должен вырасти больше, чем критический размер, прежде чем расти. продолжается (17).Ниже этого размера растущий зародыш становится все более нестабильным, так что формирование критического зародыша соответствует преодолению барьера свободной энергии (18). Широкое распределение времени начала, которое мы измеряем, свидетельствует о таком барьере и согласуется с зародышевым процессом. То, что форма распределения хорошо описывается одной экспонентой, предполагает, что существует единственный, четко определенный барьер зародышеобразования с временем зародышеобразования τ (см. Приложение SI , чтобы узнать, как мы исключаем другие барьеры, связанные с возможными неспецифическими взаимодействиями. между РНК и поверхностью).

    Колебания интенсивности раскрывают дополнительную информацию о событии зародышеобразования. Перед временем начала флуктуации соответствуют ожидаемым от дробового шума, который, как отмечалось выше, соответствует 6 димерам при усреднении за 1 с. Это измерение косвенно ограничивает критический размер ядра: если мы предположим, что белки только временно связываются с РНК до нуклеации, то подкритические ядра размером более 6 димеров не выживают дольше 1 секунды. Однако, если небольшое количество белков постоянно связывается с РНК, то эти белки могут быть не видны из-за длительного дрейфа в измерениях.

    Из-за небольшого кажущегося размера критического зародыша большинство димеров в капсиде должно добавляться во время последующей фазы роста. Мы характеризуем рост, исследуя рост интенсивности каждого следа после зарождения. Мы обнаружили, что «время роста», время, необходимое частице для достижения размера полного капсида после того, как она зародится, варьируется от частицы к частице в диапазоне от 30 до более 200 с (рис. 2 A и SI Приложение , рис. S1). Из частиц, которые превращаются в полноценный капсид, одни растут с постоянной скоростью, другие медленно по мере приближения к завершению, а третьи содержат промежуточные паузы продолжительностью до 25 с (рис.2 A и SI Приложение , Рис. S1). Несмотря на эти различия, по существу все трассы монотонны, с небольшими заметными этапами разборки или без них.

    Эти наблюдения предоставляют количественную информацию о кинетике роста капсида, а также раскрывают качественные особенности путей роста. Время роста на 4 порядка больше, чем временной масштаб, необходимый для того, чтобы димеры капсида столкнулись с РНК посредством диффузии ( SI Приложение ), что позволяет предположить, что только небольшая часть этих столкновений приводит к росту. И хотя широкое распределение времени роста и различные формы следов предполагают множество различных путей роста, отсутствие какой-либо наблюдаемой разборки предполагает, что система избегает путей, которые включают массовый сброс связанных белков.

    Кроме того, мы можем почерпнуть информацию о типах отказов в процессе сборки по следам частиц, которые вырастают значительно больше, чем капсид. Поскольку разные пути сборки могут давать сбой по-разному, устранение этих режимов сбоя дает ценную информацию об оперативных путях.Мы обнаружили, что большинство следов заросших частиц останавливаются с интенсивностью, соответствующей интенсивности капсида, прежде чем снова подняться до более высокого значения плато (Рис. 2 A и SI Приложение , Рис. S1). ПЭМ-изображения частиц, собранных вокруг непривязанной РНК, показывают, что большинство разросшихся структур состоит из капсида, прикрепленного ко второму частичному или полному капсиду ( SI Приложение , рис. S8). Эти наблюдения предполагают, что разросшиеся частицы являются результатом второго события нуклеации, которое происходит до того, как растущий капсид полностью упаковывает РНК.

    Чтобы проверить эту гипотезу, мы варьируем кинетику сборки, регулируя концентрацию белка оболочки (рис. 3 A и SI Приложение , рис. S9 и S10). Мы обнаружили, что время нуклеации уменьшается с увеличением концентрации белка, от 160 ± 40 с при 1,5 мкМ димеров до 11 ± 5 с при 4 мкМ (стандартное отклонение) (рис. 3 B и SI Приложение , рис. S5). . Это уменьшение сопровождается увеличением доли заросших частиц от примерно 5% при димерах 1,5 мкМ до более 40% при 4 мкМ (рис.3 С ). ПЭМ-изображения несвязанных частиц показывают размеры, которые примерно соответствуют конечной интенсивности, наблюдаемой на трассах, при этом многие заросшие частицы состоят из сгустков частичных или почти полных капсидов (рис. 3 D и SI Приложение , рис. S8 ).

    Рис. 3.

    Кинетика сборки при различных концентрациях белка. ( A ) Трассы интенсивности для 10 случайно выбранных частиц при 1,5 мкМ и 4 мкМ димерах белка оболочки. ( B ) Кумулятивные распределения времени начала показывают, что скорость зародышеобразования увеличивается с концентрацией белка.Данные аппроксимируются экспонентой с характерным временем зародышеобразования τ, как описано выше. Длина каждой горизонтальной полосы представляет собой погрешность каждого измерения времени. ( C ) Кумулятивные распределения конечных интенсивностей показывают, что доля разросшихся частиц увеличивается с концентрацией белка. Длина каждой горизонтальной полосы — это стандартное отклонение, рассчитанное на основе последних 50 с каждой кривой. ( D ) ПЭМ-изображения частиц, собранных вокруг непривязанной РНК.При 1,5 мкМ белка ( Left ) большинство частиц, по-видимому, являются капсидами. При 4 мкМ белка ( Right ) многие частицы представляют собой кластеры частичных капсидов.

    Время роста также уменьшается с увеличением концентрации белка, но медленнее, чем время зародышеобразования (рис. 4 A ). Таким образом, мы заключаем, что РНК, которая способствует зародышеобразованию при низкой концентрации белка, создает конкуренцию между зародышеобразованием и ростом, что может привести к разрастанию структур при более высокой концентрации, как показано на рис.4 В . Этот путь обеспечивает возможное объяснение структур «монстр» (5) и «мультиплет» (19), наблюдаемых с другими РНК-вирусами.

    Рис. 4.

    Относительные шкалы времени зарождения и роста и предполагаемые пути сборки. ( A ) Измеренное время зародышеобразования (τnuc) и среднее время роста (τgrow) при различных концентрациях белка. Планки погрешностей представляют собой стандартное отклонение от 3 повторных экспериментов. ( B ) Рисунок предполагаемых путей сборки. При низкой концентрации белка τnuc больше, чем τgrow, и ядро ​​белков оболочки формируется на РНК, а затем превращается в правильный капсид. При умеренной концентрации белка τnuc сравнимо с τgrow, и второе ядро ​​может сформироваться на РНК до того, как первое завершит рост, что приводит к разрастанию структуры, состоящей из почти полного капсида, прикрепленного к частичному капсиду. При высокой концентрации белка τnuc меньше, чем τgrow, и могут образовываться и расти несколько ядер, что приводит к разрастанию структуры, состоящей из множества частичных капсидов. Примеры изображений ПЭМ конечных точек каждого пути показаны на Справа .

    Обсуждение

    Наши измерения на отдельных капсидах MS2 позволяют нам сделать вывод об особенностях путей сборки, которые не видны при объемных измерениях, таких как наличие барьера зародышеобразования или отсутствие существенных этапов разборки. Мы не утверждаем, что эти особенности должны присутствовать при сборке in vivo; действительно, мы можем делать такие выводы только потому, что проводим наши измерения вне тесноты клетки. Кроме того, эти функции могут отличаться для других вирусов и других экспериментальных условий.Тем не менее, измерения in vitro, выполненные с использованием ряда вирусов и экспериментальных условий, оказались критически важными для понимания физики самосборки вирусов (20).

    Будь то in vitro или in vivo, белки оболочки и нити РНК многих вирусов T = 3 способны совершить замечательный подвиг: спонтанную самосборку в нетривиальную структуру с высоким выходом. Тот факт, что этот процесс трудно воспроизвести в синтетических системах, показывает, что физика все еще недостаточно изучена.Поэтому мы исследуем наши результаты в контексте общих физических моделей самосборки вирусов. Существует множество таких моделей, которые резко различаются по роли, которую играет РНК. Сравнивая наши экспериментальные результаты с предсказаниями таких моделей, мы стремимся определить, какие физические механизмы согласуются с нашими данными и что можно сделать, чтобы прийти к модели сборки, которая количественно согласуется с экспериментом.

    Прежде всего отметим, что наши результаты предостерегают от построения моделей сборки, основанных в первую очередь на статических измерениях, таких как структурные данные или равновесное сродство связывания. Такие модели подтверждают, что сборка детерминированно следует из образования специфических контактов белок-белок (13) или взаимодействий белок-РНК с высоким сродством (21). Напротив, описанные здесь сложные пути сборки и режимы отказа требуют моделей, которые отражают высокодинамичные и коллективные процессы.

    Модели зарождения и роста учитывают коллективный характер сборки. В моделях зародышеобразования пустых (22) и белковых капсидов (23), которые собираются без РНК, критическое ядро ​​формируется в массе.Но недавняя вычислительная модель, которая включает РНК как гомогенный линейный полимер (24), исследует 2 дополнительных механизма зародышеобразования. В одном ядро ​​формируется из небольшого кластера белков, адсорбированных на голой цепи РНК. С другой стороны, он образуется из белков, которые адсорбируются и агрегируются по всей цепи.

    Наши наблюдения показывают, что зародышеобразование происходит непосредственно на цепи РНК, а не в целом или в совокупности. То, что сборка зарождается, подтверждается широким распределением времени до сборки, как обсуждается в Results .Если бы нуклеация происходила в массе, мы ожидали бы большого количества пустых капсидов, но гель-электрофорез показывает, что продукты сборки содержат РНК ( SI Приложение , рис. S11). Если бы зарождение происходило в неупорядоченной совокупности белков на РНК, мы могли бы ожидать, что следы интенсивности будут выше уровня шума во время процесса агрегации, но мы не видим такого увеличения. Таким образом, мы заключаем, что зародышеобразование происходит на голых или почти голых частях РНК.

    В то время как дифракционный предел не позволяет нам напрямую измерить, где формируется ядро ​​на цепи РНК, наши результаты действительно позволяют нам проверить давнее предположение о задействованных последовательностях.В MS2 белки оболочки связываются с высокой аффинностью (Kd порядка 1 нМ) с последовательностью из 19 оснований РНК, называемой «оператором трансляции» (10), и с гораздо более низкой аффинностью (от 10 до 1000 нМ) с другими 19 основаниями. последовательности, предполагая, что этот оператор действует как сайт зародышеобразования (25). Однако наше наблюдение за порогом микромолярной концентрации для сборки предполагает, что нуклеация не зависит от связывания наномолярного сродства между белками оболочки и оператором трансляции, но, вероятно, включает другие, более слабые взаимодействия.То, что в предыдущем исследовании сообщалось о сборке при 10-кратно меньших концентрациях белка (12), не противоречит нашему наблюдаемому порогу. Вместо этого разница может отражать другой используемый буфер сборки, как описано в Приложении SI .

    Точно так же, хотя мы не можем определить высоту зародышевого барьера или размер критического зародыша непосредственно из наших измерений, мы можем установить ограничение на размер зародыша по флуктуациям интенсивности, как обсуждается в Результатах .Из-за шума в наших измерениях и конечного времени усреднения этот предел представляет собой комбинацию размера и срока службы. В частности, мы обнаружили, что подкритические кластеры должны быть либо очень маленькими (менее 6 димеров), либо очень короткоживущими (меньше, чем время усреднения, которое составляет 1 с). Если небольшое количество белков постоянно связывается с РНК, они также могут способствовать формированию ядра. В любом случае эти ограничения размера и срока службы обеспечивают конкретные количественные ограничения на модели сборки.

    Очевидный малый размер критического зародыша поднимает вопрос о том, как процесс роста обеспечивает высокие урожаи.В упрощенных моделях капсидов с Т = 1, где все белковые конфигурации идентичны (26), образования ядра может быть достаточно, чтобы гарантировать, что рост приводит к правильной структуре. Это не обязательно для капсидов с T = 3, где существуют неэквивалентные конфигурации белков и, следовательно, гораздо больше возможных неправильно собранных структур, в том числе с неправильной локальной кривизной (27). Наше наблюдение монотонного роста после нуклеации предполагает, что поступающие белки легко принимают конфигурации внутри растущего капсида, которые обеспечивают правильную кривизну. Даже при высокой концентрации белка, когда неправильно собранные частицы состоят из нескольких частичных или полных капсидов, кривизна этих капсидов не отличается от кривизны отдельных, хорошо сформированных капсидов.

    Одно из возможных объяснений состоит в том, что взаимодействия между собирающими белками смещают пути к правильным капсидам. Недавняя модель, основанная на теории непрерывной эластичности (28), предполагает, что белки оболочки принимают правильные конфигурации в капсиде по мере его роста, чтобы минимизировать упругое напряжение.Эта модель предсказывает, что количество белков в растущем капсиде должно монотонно увеличиваться со временем, что согласуется с нашими измерениями фазы роста. Для дальнейшего тестирования этой модели мутантные белки оболочки с различными взаимодействиями могут быть использованы для исследования роли упругого стресса в контроле путей роста.

    Другое объяснение состоит в том, что взаимодействия белок-РНК направляют пути роста. Некоторые модели предполагают, что рост капсида определяется общими электростатическими взаимодействиями между белками оболочки и РНК (29).Однако более поздняя модель предполагает, что «множественные диспергированные, специфические взаимодействия» (ref. 7, p. 74) между белками и битами вторичной структуры РНК направляют поступающие белки в правильные локальные конфигурации. Недавние эксперименты с MS2 — включая биохимические (30), структурные (31) и объемные кинетические (12) измерения — предоставляют косвенные доказательства того, что такие структуры участвуют в сборке капсида, но не решают, как они влияют на процесс роста. Поскольку наш метод совместим с цепями РНК произвольной последовательности и буферами сборки произвольной ионной силы, будущие исследования могут проверить эти модели, изменяя отдельные структуры РНК или силу электростатических взаимодействий, а затем измеряя изменения в путях роста.

    Выводы

    Наши измерения порога нуклеации, времени нуклеации, докритических флуктуаций и времени роста в MS2 обеспечивают важные количественные ограничения на моделирование путей сборки (24). В результате структуры критического ядра и последующих промежуточных состояний, которые долгое время ускользали от прямых методов визуализации, теперь могут быть выведены путем количественного сравнения наших измерений и подобных имитаций. Понимание путей сборки вирусных капсидов на этом уровне детализации может дать информацию о стратегиях блокирования сборки патогенных вирусов (32) или для создания синтетических капсидов (33).

    Наконец, хотя наши наблюдения специфичны для путей сборки in vitro, они предоставляют физическую гипотезу репликации вируса in vivo. Поскольку РНК внутри капсида не может транслироваться или реплицироваться, РНК-вирусы должны задерживать сборку капсида и упаковку генома до тех пор, пока не будет произведено множество копий их белков и генома. Путь сборки с концентрационным порогом для зародышеобразования — такой, который мы наблюдаем — обеспечил бы такую ​​задержку. Более того, эта задержка позволит концентрации вновь реплицированной вирусной РНК увеличиться по сравнению с фоновой концентрацией цепей РНК хозяина, увеличивая вероятность того, что вирусная РНК упакована.

    Материалы и методы

    Рост MS2 и очистка его белка оболочки и РНК.

    Мы выращиваем MS2 дикого типа (подарок Питера Стокли из Университета Лидса, Лидс, Великобритания), заражая жидкие культуры штамма E. coli C3000 (также подарок Питера Стокли) и очищая потомство вирусов. протоколы Штрауса и Зиншеймера (34). Мы очищаем димеры белка оболочки (2 × 13,7 = 27,4 кДа) из вирусных частиц с помощью метода холодной уксусной кислоты, описанного Сугиямой, Хебертом и Хартманом (2).Мы очищаем РНК MS2 (1,1 МДа) из недавно выращенных вирусных частиц с помощью набора для экстракции РНК (RNeasy; Qiagen). Наша процедура оценки концентрации и чистоты этих материалов описана в Приложении SI , рис. S11 и S12.

    Микроскоп.

    Наш микроскоп аналогичен микроскопу, описанному Ortega-Arroyo et al. (35) и настроен в широкопольном режиме без сканирования луча. Подробности приведены в приложении SI , рис. S13. Мы используем свет с длиной волны 450 нм и интенсивностью освещения ∼3 кВт / см2.Контрольные эксперименты при различной интенсивности освещения показывают, что используемая интенсивность не влияет на кинетику сборки ( SI Приложение , рис. S14). Общее поле зрения составляет 140 пикселей × 140 пикселей (9,8 мкм × 9,8 мкм). Изображения записываются с частотой 1000 Гц. Для борьбы с механическим дрейфом при длительности измерения 900 с положение покровного стекла относительно объектива активно стабилизируется до нескольких нанометров во всех трех измерениях с помощью пьезоэлектрических приводов, как подробно описано в Приложении SI .

    Интенсивность изображения.

    Собирающиеся частицы выглядят как темные дифракционные пятна. Интенсивность каждого пятна приблизительно линейно пропорциональна количеству белков, связанных с цепью РНК. Интенсивность пятна равна I = Ir + Is + 2IrIscosϕrs, где Ir — интенсивность отраженной волны, Is — интенсивность рассеянной волны, а ϕrs — разность фаз между ними. Членом Is можно пренебречь, поскольку рассеянный свет тусклый по сравнению с отраженным светом, поэтому нормированная интенсивность Inorm = I / Ir − 1 пропорциональна общей поляризуемости собирающейся частицы (15), которая приблизительно равна сумме белковый компонент и компонент РНК.Ранее мы показали, что эта линейная суперпозиция является хорошим приближением для частиц бактериофага λ, которые состоят из белкового капсида, окружающего одну молекулу плотно упакованной ДНК (36). Здесь, поскольку компонент РНК статичен, он является частью фона и вычитается нашей процедурой обработки изображений, которая описана в приложении SI . В результате нормализованная интенсивность линейно пропорциональна количеству белков в собирающейся частице, что согласуется с другими исследованиями мультипротеиновых комплексов (15).

    Калибровка микроскопа.

    Мы калибруем измерения интенсивности с помощью микроскопа, используя 2 частицы известной массы: нити РНК MS2 и частицы вируса MS2 дикого типа ( SI Приложение , рис. S2). Мы делаем вывод о распределении интенсивности, соответствующем капсидам дикого типа, свертывая распределение интенсивности частиц дикого типа с отрицательным из распределения интенсивности РНК. Мы используем это предполагаемое распределение интенсивности для оценки интенсивности полных капсидов, которые собираются в наших экспериментах, как показано серыми полосами на рис.2 A и 3 A . Распределение намного шире, чем ожидаемое массовое распределение для капсидов дикого типа, которые довольно монодисперсны. Таким образом, ширина распределения отражает неопределенность наших измерений.

    Функционализация покровного стекла и связывание РНК.

    Мы адаптируем протоколы, описанные Джу и Ха (37), для покрытия покровных стекол слоем молекул полиэтиленгликоля (ПЭГ), около 1% из которых функционализированы цепочкой ДНК из 20 оснований.Последовательность поверхностно-связанной ДНК — GGTTGGTTGGTTGGTTGGTT. Мы дополнительно украшаем покровные стекла 30-нанометровыми частицами золота, пассивированными ПЭГ, которые служат в качестве индикаторов для активной стабилизации. Непосредственно перед каждым экспериментом мы инкубировали покровные стекла с раствором детергента, содержащим 0,2% твин-20, чтобы пассивировать любые незащищенные пятна на покрытии PEG. Затем мы привязываем цепи РНК MS2 к покровным стеклам, используя линкерную цепь ДНК из 60 оснований: 40 оснований на 5′-конце линкера комплементарны 40 основаниям на 5′-конце РНК, а оставшиеся 20 оснований являются комплементарен последовательности поверхностно-связанной ДНК ( SI Приложение , рис.S15). Последовательность линкера CGACAGGAAGTTGAGCAGGACCCCGAAAGGGGTCCCACCCAACCAACCAACCAACCAACC. Мы гибридизуем РНК с линкером путем термического отжига в буфере для гибридизации (50 мМ Tris⋅HCl, pH 7,0; 200 мМ NaCl; 1 мМ ЭДТА), а затем позволяем полученным комплексам РНК-ДНК связываться с функционализированной ДНК поверхностью при комнатной температуре. температура. Связывание с поверхностью является высокоспецифичным ( SI Приложение , рис. S16). Подробная информация об этапах функционализации, термического отжига и поверхностного связывания приведена в Приложении SI .

    Эксперимент по кинетике сборки.

    Мы вводим димеры белков оболочки в цепочки РНК, связанные с поверхностью, с помощью самодельных проточных кювет. Крыша и стенки ячеек сделаны из акрила, а пол состоит из описанного выше покровного стекла, функционализированного РНК. Подробные сведения о конструкции проточных ячеек приведены в Приложении SI , рис. S17. Для проведения эксперимента по сборке мы промываем проточную кювету буфером для сборки (42 мМ Tris⋅HCl, pH 7,5; 84 мМ NaCl; 3 мМ уксусная кислота; 1 мМ EDTA), начинаем запись фильма с помощью микроскопа интерферометрического рассеяния, а затем введите 10 мкл указанной концентрации несобранных димеров в буфере для сборки с помощью шприцевого насоса.Вводимый объем примерно в 3 раза больше, чем объем камеры для пробы. Инъекция начинается с 4 с в фильм и продолжается 20 с. Оценка того, сколько времени требуется введенным димерам, чтобы достичь цепей РНК, связанных с поверхностью, описана в Приложении SI , рис. S7. Мы проводим 3 повторных эксперимента для всех измерений микроскопии интерферометрического рассеяния с 1,5-, 2- и 4-мкМ димерами белка оболочки. Данные этих повторов показаны на рис. 4 A, и SI, приложение , рис.S5. Мы также проводим контрольный эксперимент, в котором мы привязываем только цепь ДНК-линкера к поверхности покровного стекла, без РНК, а затем выполняем измерение с помощью микроскопии интерферометрического рассеяния с димерами 2 мкМ. Результаты этого контроля обсуждаются в Приложении SI и показаны в Приложении SI , рис. S3.

    Анализ следов интенсивности.

    Время начала для каждой кривой определяется как время, когда интенсивность достигает 0,001. Чтобы определить время роста, мы сначала выполняем линейную аппроксимацию методом наименьших квадратов для части каждой кривой, которая находится между временем начала и временем, когда интенсивность впервые достигает интенсивности полного капсида. Затем мы оцениваем время, необходимое для выращивания полного капсида (связывания 90 димеров), аппроксимируя скорость роста как наклон линейной аппроксимации. Подробности этого анализа описаны в Приложении SI .

    ТЕМ.

    Мы используем отрицательно окрашенный ПЭМ для изображения белковых структур, которые собираются вокруг РНК, которая либо связана с функционализированной наночастицей золота (как на рис. 2 B и SI, приложение , рис. S4), либо свободными в растворе (как на рис.3 D и SI Приложение , рис.S8). Метод, используемый для функционализации поверхностей золотых частиц, аналогичен методу, используемому для покровных стекол, и подробно описан в Приложении SI . Реакцию сборки проводят в буфере для сборки путем смешивания указанной микромолярной концентрации димеров белка оболочки либо с 0,2 нМ РНК-меченых частиц золота, либо с 10 нМ свободной РНК. Эту смесь оставляют на 10 мин при комнатной температуре, а затем добавляют к протравленному плазмой ТЭМ с углеродным покрытием (Ted Pella), окрашивают раствором красителя метиламина вольфрамата (Nanoprobes) и визуализируют на ТЕМ Tecnai F20 (FEI). работал на 120 кВ.Дополнительные сведения о подготовке образцов для ПЭМ и визуализации приведены в Приложении SI .

    Доступность данных.

    Все представленные данные доступны у соответствующего автора по разумному запросу.

    Благодарности

    Мы благодарим Эми Баркер и Питера Стокли из Университета Лидса за начальные запасы бактериофага MS2 и клеток E. coli . Мы благодарим Филипа Кукуру, Марека Пилиарика, Вахида Сандогдара, Уильяма Джейкобса и Майкла Бреннера за полезные обсуждения.Эта работа поддержана Гарвардским центром материаловедения и инженерии в рамках гранта DMR-1420570 Национального научного фонда (NSF); стипендия для аспирантов NSF по гранту DGE-1144152; Национальный институт общих медицинских наук Национальных институтов здравоохранения по гранту K99GM127751; Центр математического и статистического анализа биологии NSF-Simons при Гарвардском университете в рамках гранта 1764269; и Гарвардская инициатива в области количественной биологии. Эта работа была частично выполнена в Гарвардском центре наномасштабных систем при поддержке NSF Grant 1541959.

    Сноски

    • Автор: R.F.G. и A.M.G. спроектировал экспериментальную установку, провел эксперименты и проанализировал данные; А.М.Г., Р.Ф.Г. и В.Н.М. написал статью; и В.Н.М. предложил изучить самосборку вируса с помощью интерферометрической рассеивающей микроскопии и руководил проектом.

    • Авторы заявляют об отсутствии конкурирующей заинтересованности.

    • Эта статья представляет собой прямое представление PNAS.

    • См. Комментарий на стр. 22420.

    • Эта статья содержит вспомогательную информацию на сайте www.pnas.org/lookup/suppl/doi:10.1073/pnas.13116/-/DCSupplemental.

    • Copyright © 2019 Автор (ы). Опубликовано PNAS.

    (PDF) КриоЭМ-структура ядра вируса гепатита В 3,5Å, собранная из полноразмерного ядра белка

    Номера доступа

    Представленная криоЭМ карта плотности и атомные координаты

    депонированы в банке данных ЭМ и данных о белках

    Банк с кодами доступа EMD-2278 и 3J2V соответственно.

    Вклад авторов

    Задумал и спроектировал эксперименты: ZHZ XY LJ.

    Проведены эксперименты: XY LJ. Проанализированы данные: XY

    ZHZ. Написал рукопись: XY ZHZ. Построены атомные модели:

    JJ XY. Интерпретированные результаты: XY ZHZ CS.

    Ссылки

    1.

    Паркин Д.М., Пизани П., Ферли Дж. (1999) Оценки глобальной

    случаев 25 основных видов рака в 1990 году. Int J Cancer 80: 827-841.DOI:

    10.1002 / (SICI) 1097-0215 ​​(199) 80: 6. PubMed: 10074914.

    2.

    Chisari FV, Ferrari C (1995) Иммунопатогенез вируса гепатита B.

    Annu Rev Immunol 13: 29-60. DOI: 10.1146 / annurev.iy.

    13.040195.000333. PubMed: 7612225.

    3. Сигер С., Мейсон В.С. (2000) Биология вируса гепатита В. Microbiol Mol

    Biol Rev 64: 51-68. DOI: 10.1128 / MMBR.64.1.51-68.2000. PubMed:

    10704474.

    4.Nassal M, Schaller H (1993) Репликация вируса гепатита B. Тенденции

    Microbiol 1: 221-228. DOI: 10.1016 / 0966-842X (93) -F. PubMed:

    8137119.

    5. Драйден К. А., Виланд С. Ф., Уиттен-Бауэр С., Герин Дж. Л., Чисари Ф. В. и др.

    (2006) Нативные вирионы и капсиды гепатита B, визуализированные с помощью электронной криомикроскопии

    . Mol Cell 22: 843-850. DOI: 10.1016 / j.molcel.

    2006.04.025. PubMed: 167.

    6.

    Milich DR, Jones JE, Hughes JL, Price J, Raney AK et al.(1990) Является ли

    функцией секретируемого е антигена гепатита В индуцировать иммунологическую толерантность к

    внутриутробно? Proc Natl Acad Sci U S A 87: 6599-6603. DOI:

    10.1073 / pnas.87.17.6599. PubMed: 23.

    7.

    Chen MT, Billaud JN, Sällberg M, Guidotti LG, Chisari FV et al. (2004)

    Функция белка предсердия вируса гепатита В заключается в регуляции иммунного ответа

    на основной антиген. Proc Natl Acad Sci U S A 101:

    14913-14918.DOI: 10.1073 / pnas.0406282101. PubMed: 15469922.

    8.

    Takahashi K, Machida A, Funatsu G, Nomura M, Usuda S et al. (1983)

    Иммунохимическая структура е-антигена гепатита В в сыворотке крови. J

    Immunol 130: 2903-2907. PubMed: 6189903.

    9.

    Standring DN, Ou JH, Masiarz FR, Rutter WJ (1988) Сигнальный пептид

    , кодируемый в прекоровой области вируса гепатита B, управляет секрецией

    гетерогенной популяции е-антигенов. в ооцитах Xenopus

    .Proc Natl Acad Sci U S A 85: 8405-8409. DOI: 10,1073 / PNAS.

    85.22.8405. PubMed: 3186731.

    10.

    Коэн BJ, Richmond JE (1982) Электронная микроскопия антигена ядра гепатита B

    , синтезированного в E. coli. Nature 296: 677-679. DOI:

    10.1038 / 296677a0. PubMed: 7040981.

    11.

    Кроутер Р.А., Киселев Н.А., Бёттчер Б., Берриман Дж. А., Борисова Г.П. и др.

    (1994) Трехмерная структура ядерных частиц вируса гепатита В

    , определенная с помощью электронной криомикроскопии.Ячейка 77: 943-950. DOI:

    10.1016 / 0092-8674 (94) -2. PubMed: 8004680.

    12.

    Kenney JM, von Bonsdorff CH, Nassal M, Fuller SD (1995)

    Эволюционная консервация в структуре ядра вируса гепатита B:

    Сравнение ядер человека и утки. Структура 3: 1009-1019. DOI:

    10.1016 / S0969-2126 (01) 00237-4. PubMed: 8589996.

    13.

    Petit MA, Pillot J (1985) HBc и HBe антигенность и ДНК-связывание

    активность основного корового белка P22 в ядерных частицах вируса гепатита B

    , выделенных из цитоплазмы клеток печени человека .Дж. Вирол 53: 543-551.

    PubMed: 2578575.

    14.

    Nassal M (1992) Богатый аргинином домен белка ядра вируса гепатита B

    необходим для инкапсидации прегенома и синтеза ДНК с положительной цепью вируса

    , но не для вируса сборка. Дж. Вирол 66:

    4107-4116. PubMed: 1602535.

    15.

    Böttcher B, Wynne SA, Crowther RA (1997) Определение складки

    корового белка вируса гепатита B с помощью электронной криомикроскопии.Природа

    386: 88-91. DOI: 10.1038 / 386088a0. PubMed: 86.

    16.

    Conway JF, Cheng N, Zlotnick A, Wingfield PT, Stahl SJ et al. (1997)

    Визуализация пучка из 4 спиралей в капсиде вируса гепатита В с помощью крио-

    электронной микроскопии. Nature 386: 91-94. DOI: 10.1038 / 386091a0.

    PubMed: 87.

    17.

    Roseman AM, Berriman JA, Wynne SA, Butler PJ, Crowther RA (2005)

    Структурная модель созревания ядра вируса гепатита B.Proc Natl

    Acad Sci U S A 102: 15821-15826. DOI: 10.1073 / pnas.0504874102.

    PubMed: 16247012.

    18. Винн С.А., Кроутер Р.А., Лесли А.Г. (1999) Кристаллическая структура капсида вируса гепатита В человека

    . Mol Cell 3: 771-780. DOI: 10.1016 /

    S1097-2765 (01) 80009-5. PubMed: 103

  • .

    19. Zhou S, Standring DN (1992) Частицы капсида вируса гепатита В представляют собой

    , собранные из предшественников димеров корового белка.Proc Natl Acad Sci U S

    A 89: 10046-10050. DOI: 10.1073 / pnas.89.21.10046. PubMed: 1438193.

    20.

    Zhou S, Standring DN (1992) Остатки Cys капсидного белка вируса гепатита B

    не являются существенными для сборки вирусных ядерных частиц

    , но могут влиять на их стабильность. Дж. Вирол 66: 5393-5398. PubMed:

    1501280.

    21.

    Zheng J, Schödel F, Peterson DL (1992) Структура коровых антигенов гепаднавируса

    .Идентификация свободных тиолов и определение структуры дисульфидных связей

    . J Biol Chem 267: 9422-9429. PubMed:

    1577770.

    22.

    Uetrecht C, Versluis C, Watts NR, Roos WH, Wuite GJ et al. (2008)

    Масс-спектрометрия с высоким разрешением вирусных ансамблей: молекулярный

    состав и стабильность диморфных капсидов вируса гепатита В. Proc

    Natl Acad Sci U S A 105: 9216-9220.DOI: 10.1073 / pnas.0800406105.

    PubMed: 18587050.

    23.

    Uetrecht C, Versluis C, Watts NR, Wingfield PT, Steven AC et al.

    (2008) Стабильность и форма капсидов вируса гепатита В в вакууме. Angew

    Chem Int Ed Engl 47: 6247-6251. DOI: 10.1002 / anie.200802410.

    PubMed: 18642251.

    24. Watts NR, Conway JF, Cheng N, Stahl SJ, Steven AC et al. (2011)

    Роль пропептида в контроле конформации и состояния сборки

    е-антигена вируса гепатита В.J Mol Biol 409: 202-213. DOI: 10.1016 /

    j.jmb.2011.03.049. PubMed: 21463641.

    25.

    Jeng KS, Hu CP, Chang CM (1991) Дифференциальное образование дисульфидных связей

    в коровом антигене внеклеточных и внутриклеточных ядерных частиц вируса гепатита B

    . Дж. Вирол 65: 3924-3927. PubMed: 2041102.

    26.

    Галлина А., Бонелли Ф., Зентилин Л., Ринди Дж., Муттини М. и др. (1989) Рекомбинантный полипептид корового антигена гепатита В

    с удаленным протамин-

    -подобным доменом самособирается в частицы капсида, но не может связывать нуклеиновые кислоты

    .Дж. Вирол 63: 4645-4652. PubMed: 2677399.

    27.

    Seifer M, Standring DN (1994) Чувствительный к протеазе шарнир, связывающий

    два домена корового белка вируса гепатита B, экспонируется на поверхности капсида вируса

    . Дж. Вирол 68: 5548-5555. PubMed: 7520091.

    28. Li HC, Huang EY, Su PY, Wu SY, Yang CC et al. (2010) Ядерный экспорт

    и импорт капсидного белка и частиц вируса гепатита В человека.

    PLOS Pathog 6: e1001162.PubMed: 21060813.

    29. Rosenthal PB, Henderson R (2003) Оптимальное определение ориентации частиц

    , абсолютная рука и потеря контраста в одночастичной электронной криомикроскопии

    . J Mol Biol 333: 721-745. DOI: 10.1016 / j.jmb.

    2003.07.013. PubMed: 14568533.

    30. Эмсли П., Коутан К. (2004) Кут: инструменты построения моделей для молекулярной графики

    . Acta Crystallogr D Biol Crystallogr 60: 2126-2132. DOI:

    10.1107 / S04

    9158. PubMed: 15572765.

    31.

    Birnbaum F, Nassal M (1990) Сборка нуклеокапсида вируса гепатита B:

    Требования к первичной структуре основного белка. J Virol 64:

    3319-3330. PubMed: 21

    .

    32. Hatton T, Zhou S, Standring DN (1992) РНК- и ДНК-связывающая активность

    в капсидном белке вируса гепатита B: модель их роли в репликации вируса

    . Дж. Вирол 66: 5232-5241.PubMed: 1501273.

    33. Wingfield PT, Stahl SJ, Williams RW, Steven AC (1995) Ядро гепатита

    Антиген

    , продуцируемый в Escherichia coli: состав субъединиц, конформационный анализ

    и сборка капсида in vitro. Биохимия 34:

    4919-4932. DOI: 10.1021 / bi00015a003. PubMed: 7711014.

    34. Newman M, Chua PK, Tang FM, Su PY, Shih C (2009) Проверка гипотезы электростатического взаимодействия

    стабильности капсида вируса гепатита B

    с использованием системы разборки / повторной сборки капсида in vitro . J Virol 83:

    10616-10626. DOI: 10.1128 / JVI.00749-09. PubMed: 19656897.

    35. Liu S, He J, Shih C., Li K, Dai A. et al. (2010) Структурные сравнения

    частиц корового антигена гепатита В с различной длиной С-конца. Вирус

    Res 149: 241-244. DOI: 10.1016 / j.virusres.2010.01.020. PubMed:

    20144668.

    36. Злотник А., Ченг Н., Шталь С.Дж., Конвей Дж.Ф., Стивен А.С. и др. (1997)

    Локализация C-конца сборочного домена вируса гепатита B

    Капсидный белок вируса: значение для морфогенеза и организации

    инкапсидированной РНК.Proc Natl Acad Sci U S A 94: 9556-9561. DOI:

    10.1073 / pnas.94.18.9556. PubMed:

    61.

    Атомная модель ядра HBV от CryoEM

    PLOS ONE | www.plosone.org 10 сентября 2013 г. | Том 8 | Выпуск 9 | e69729

    Гены | Бесплатный полнотекстовый | Транскриптомный анализ развития пещерных ракообразных, Asellus aquaticus

    1. Введение

    Пещерные животные — удивительные организмы, которые часто имеют общий набор характеристик, включая уменьшенные глаза, пониженную пигментацию, метаболические различия и улучшенные сенсорные системы.Вопросы, которые давно интересовали пещерных биологов, включают в себя, как и почему эти характеристики эволюционировали, и являются ли одни и те же лежащие в основе механизмы опосредованием потери черт между разными пещерными популяциями и разными пещерными видами.

    Исторически сложилось так, что понять, как и почему изменились характеристики пещер, было сложно из-за трудностей с выращиванием пещерных организмов в неволе и отсутствия современных экспериментальных ресурсов (например, геномных, генетических и функциональных молекулярных инструментов) для большинства пещерных видов.Однако в последние годы были значительно расширены и улучшены ресурсы и инструменты для появляющихся модельных организмов. Получение геномной информации теперь возможно для большинства систем, а полная геномная последовательность доступна для ограниченного числа обитающих в пещерах видов [1,2]. Кроме того, многие исследования включали проекты секвенирования транскриптомов для пещерных обитателей, таких как раки, саламандры, амфиподы, равноногие и рыбы [3,4,5,6,7,8]. В подавляющем большинстве этих проектов использовались образцы взрослых особей из-за проблемы получения образцов эмбрионов естественных, обитающих в пещерах видов.Однако для нескольких пещерных видов многие различия признаков устанавливаются на ранних этапах эмбрионального развития, что подчеркивает важность (и ценность) анализа различий в экспрессии генов в ходе эмбрионального развития. Наиболее широко изученным модельным видом пещер является Astyanax mexicanus, где можно работать. с эмбрионами и получить образцы эмбрионов, а также выполнить генетический анализ (см. обзор [9,10]). Были созданы как взрослые, так и эмбриональные транскриптомы, а также проект последовательности генома для пещерных и поверхностных морфов [2,11,12].Кроме того, современные геномные инструменты, такие как редактирование генов, предоставляют возможность функционального анализа генов-кандидатов, обнаруженных посредством секвенирования транскриптома [13,14,15]. Благодаря большому количеству данных, предоставленных этими новыми ресурсами, теперь можно найти ответы на исторические вопросы, влияющие на эволюцию пещерных животных (см. Обзоры в [16,17]).

    Несмотря на большой объем информации, полученной в результате десятилетий исследований A. mexicanus, необходимы исследования дополнительных пещерных организмов, чтобы понять конвергенцию регрессивных потерь среди животных, населяющих биом пещеры.В частности, механизмы, которые опосредуют регрессивную потерю у A. mexicanus, могут отличаться от механизмов, действующих у других адаптированных к пещерам видов. Таким образом, важно развивать другие виды аналогично A. mexicanus, чтобы расширить нашу перспективу и получить более широкое понимание того, как эволюция пещер происходит в различных таксонах.

    К сожалению, не каждое пещерное животное поддается развитию в качестве модели так же, как A. mexicanus. Есть много соображений, главным из которых является способность выращивать и разводить вид в лаборатории.Эта функция значительно сокращает количество адаптированных к пещерам видов, для которых возможны генетические исследования и исследования развития. Другой важной особенностью этих исследований является сохранившаяся форма обитания на поверхности, способная скрещиваться с пещерными морфами. Из-за различий во времени между пещерными и поверхностными морфами способность производить жизнеспособное гибридное потомство очень необычно среди изученных пещерных организмов.

    Asellus aquaticus — пресноводное ракообразное, имеющее две морфы, пещерную и поверхностную, обе из которых можно выращивать в лаборатории и скрещивать [18].Большая часть исторических работ по Asellus aquaticus включает сравнительную морфологию между поверхностными и пещерными формами, а также популяционно-генетический анализ нескольких пещерных и поверхностных популяций по всей Европе [19,20,21,22,23,24]. Недавно стало возможным применение классического генетического подхода с помощью нескольких стратегий скрещивания для создания родословных F1, F2 и обратного скрещивания между пещерными и поверхностными популяциями. Эти исследования привели к созданию карты сцепления, пониманию генетической архитектуры этого вида и идентификации геномных регионов, ассоциированных с различными фенотипами, связанными с пещерами [25,26,27].Хотя в области геномного картирования наряду с разработкой генетических ресурсов были достигнуты успехи, идентичность генов, ответственных за эти черты различий между пещерными и поверхностными формами, остается неизвестной. Мощным подходом к выявлению генетических различий между пещерными и наземными формами является сравнительная транскриптомика. Транскриптомы были охарактеризованы для популяции в проливе Пивка пещеры Планина, популяции в пещере Мольнар Янош и близлежащих поверхностных популяций обеих пещер [6,28].Хотя эти исследования были полезны для создания генетических ресурсов, причинные гены, опосредующие различия между пещерным и поверхностным населением, не были установлены. Частично проблема, как обсуждалось выше, состоит в том, что образцы взрослых особей не являются наиболее подходящими, так как многие различные характеристики между пещерными и поверхностными особями устанавливаются во время эмбрионального развития [27,29]. Например, потеря зрения и потеря пигмента устанавливаются к концу эмбриогенеза. Для исследования генетических путей, ответственных за потерю глаз и пигмента, наиболее подходящими для секвенирования образцами будут образцы, полученные в данный момент эмбрионального развития.

    Чтобы восполнить этот пробел в знаниях, мы сгенерировали de novo эмбриональные транскриптомы из одной пещеры и одной поверхностной популяции, а также из гибридных особей. Мы предположили, что многие гены будут по-разному экспрессироваться между пещерными и поверхностными формами, включая те, которые участвуют в нейрогенезе, развитии пигмента, развитии глаз и метаболизме. Кроме того, мы ожидали, что подмножество этих дифференциально экспрессируемых генов также будет демонстрировать аллель-специфическую экспрессию, предполагая, что регуляторные мутации приводят к изменению количества транскрипции для этих генов.

    2. Материалы и методы

    2.1. Животные
    Животные были собраны в Ракове Шкоцяне (на поверхности) и в проливе Рак в пещере Планина (пещера) (рис. 1A). Животных выращивали в воде, освещении и пищевых условиях, как описано ранее [25,26,27]. Вкратце, животных содержали в инкубаторе при 12 ° C без света и подвергали воздействию света только тогда, когда их вынимали из инкубатора или открывали дверцу инкубатора. Надводных животных выращивали в резервуарах по 10 особей в резервуаре.Точно так же пещерных животных выращивали в резервуарах примерно по 10 особей в резервуаре. Гибридные кроссы были созданы путем скрещивания одного пещерного самца с одной самкой на поверхности. Когда в любом из вышеуказанных резервуаров наблюдали самку с эмбрионами, за самками наблюдали до тех пор, пока эмбрионы не прошли примерно 70% пути развития. Затем их удалили из самки, используя раствор гвоздичного масла 20 мкл в 50 мл пресной воды, как описано ранее [27]. Эмбрионы содержались в небольшой посуде с коммерческой родниковой водой (Crystal Geyser) до тех пор, пока они не достигли 90% эмбрионального развития, когда и пигментация, и зарождающиеся омматидии присутствовали на поверхности, но не в пещере, эмбрионах (Рисунок 1B, C) [27] .
    2.2. Экстракция РНК, подготовка библиотеки и секвенирование

    Весь выводок при 90% эмбрионального развития использовался для одного образца, который варьировался от 25–89 эмбрионов. Эмбрионы экстрагировали в 200 мкл TRIzol (Thermofisher, Waltham, MA, USA) и механически разрушали с помощью пестика Eppendorf. Образцы были отправлены в лабораторию функциональной геномики лаборатории геномного секвенирования Винсента Дж. Коутса, Калифорнийский институт количественных биологических наук (QB3) Калифорнийского университета в Беркли.Тотальную РНК экстрагировали с использованием протокола TRIzol Thermofisher. Был проведен отбор PolyA, и подготовка библиотеки была выполнена с использованием протокола низкого ввода набора Nugen. Секвенирование выполнялось с использованием парных считываний с конца 150 п.о. на секвенаторах Illumina HiSeq 4000 и HiSeq 2500 для обеспечения качественного набора данных с помощью средства секвенирования.

    2.3. De Novo Transcriptome Assembly and Annotation
    Всего девять образцов, из которых было получено 36 файлов fastq, были обработаны для сборки и аннотации транскриптома.Мы оценили три образца эмбрионов Asellus cave (MPD1, MPD5, MPD6), три образца поверхностных эмбрионов (MPD2, MPD3, MPD8) и три гибридных эмбриональных образца (MPD4, MPD7, MPD9), подвергнутых парному секвенированию и обработанных в двух экземплярах ( всего = 36 файлов). Чтобы добиться наиболее точного картирования для последующих исследований РНК-seq, мы построили специфичные для морфотипа транскриптомы с помощью SeqMan NGen (DNAStar, Madison, WI, США). Первоначальные сборки de novo использовали параметры сборки по умолчанию для SeqMan NGen, включая размер mer, равный 21, минимальный процент совпадения 80% и максимальный размер кластера 100 000, что приводило к не полностью собранным контигам.Это было основано на том факте, что параметры по умолчанию давали гораздо меньше транскриптов длиной> 1 т.п.н. Мы стремились увеличить среднюю длину стенограммы наших сборок и протестировали множество параметров. Мы нашли оптимальные результаты, когда скорректировали размер mer (19) и увеличили минимальный процент соответствия (до 97%) и максимальный размер кластера (до 300 000). Этот подход привел к 30% увеличению числа транскриптов длиной> 1 т.п.н. (с 37 769 до 49 146 в поверхностной сборке).Этот подход также обеспечил самую большую среднюю длину транскриптов (поверхность = 1061 п.н., пещера = 1069 п.н., гибриды = 952 п.н.), а также наиболее собранные транскрипты длиной> 1 т.п.н. (поверхность = 49 233, пещера = 51 822, гибриды = 52 390. ; Таблица 1). Кроме того, мы выполнили анализ BUSCO и обнаружили очень похожие результаты для всех трех транскриптомов, а также «интегрированный транскриптом», который использовал каждое считывание, которое мы сгенерировали (дополнительный рисунок S1). Мы чувствовали, что самые длинные транскрипты представляют собой лучшие индивидуальные сборки транскриптов, и поэтому приступили к аннотированию тех собранных транскриптов, которые были 1000 п.н. или больше.Все аннотации проводились с помощью Blast2GO (v.5.2.5) под управлением Java v.1.8.0_144. Чтобы получить наиболее полную информацию, мы выполнили два раунда аннотаций, связанных с BLAST, для каждого из трех транскриптомов — один с использованием генома Tribolium castaneum в качестве ссылки, а другой с использованием базы данных SwissProt (Таблица 2). Последняя версия базы данных SwissProt была загружена из Blast2GO по следующей ссылке: https://ftp.ncbi.nlm.nih.gov/blast/db. База данных Tribolium, используемая для нашей аннотации на основе взрыва, была загружена с ftp. ncbi.nlm.nih.gov. Мы использовали ссылку на Tribolium, которая была загружена в марте 2016 года. Хотя база данных SwissProt постоянно обновляется, обе базы данных были извлечены (и все задачи по аннотации были выполнены) в мае 2018 года. Вкратце, мы отправили файл в формате fasta, содержащий все Последовательности, собранные novo, в Blast2GO, указали нашу интересующую базу данных и выполнили все шаги аннотации по умолчанию. Мы реализовали сценарий для удаления всех аннотированных транскриптов, связанных с рибосомными или митохондриальными последовательностями, которые варьировались от 734 до 1066 последовательностей с идентифицированным взрывом.Для всех трех транскриптомов (поверхностный, пещерный и гибридный) мы получили сопоставимые результаты для обеих баз данных; однако ссылка на Tribolium castaneum предоставила наибольшее количество успешных аннотаций.
    2.4. Анализ секвенирования и экспрессии РНК

    После завершения аннотации с помощью Blast2GO мы выполнили анализ секвенирования РНК с помощью ArrayStar (v.13; DNAStar, Мэдисон, Висконсин, США). Мы выполнили анализ РНК-seq для всех ссылок на транскриптом (например, Tribolium castaneum и SwissProt).В частности, мы сопоставили чтения из всех наших эмбриональных образцов со всеми нашими ссылками на транскриптомы. Все наши анализы дали очень похожие результаты. Наш рабочий процесс включал отображение последовательности считываний всех трех морфотипов (пещерный, поверхностный и гибридный). Результаты экспрессии генов были нормализованы с использованием считываний на килобаз на миллион картированных (RPKM). Эта стратегия нормализации необходима для контроля различий в глубине секвенирования между образцами и для сравнения уровней экспрессии транскриптов, которые различаются по длине.Наш результирующий набор данных включал меру линейного общего RPKM, которая обеспечивает статистическую метрику выражения, которую можно было сравнивать между наборами данных. Затем этот показатель использовался для сравнения экспрессии (на основе разницы кратных изменений) между группами (например, пещера по сравнению с поверхностью).

    Мы сравнили сборки различных справочных файлов транскриптомов, чтобы оценить согласованность этой расчетной метрики выражения, и обнаружили, что они очень похожи. Однако наш процесс аннотации с использованием Blast2Go периодически приводил к более чем одному попаданию в одну ортологическую справочную расшифровку.Чтобы справиться с этой проблемой, мы усреднили значения выражений (то есть значения RPKM) для контигов, которые были преобразованы в одну и ту же контрольную расшифровку. Это дало наиболее точное значение экспрессии для каждого аннотированного гена. Этот расчет позволил нам скорректировать множественные попадания в одну и ту же ссылку, однако он мог непреднамеренно свернуть выражения для разных изоформ (или паралогов) в единую транскрипцию. В рамках этого проекта не удалось оценить возможность появления изоформ или паралогов, специфичных для Asellus aquaticus, — предостережение, которое необходимо будет рассмотреть в будущих проектах по секвенированию генома.Наконец, учитывая недоступность свежих тканей (с помощью которых можно извлечь РНК для количественной проверки ПЦР), мы использовали различные фильтры, чтобы максимизировать достоверность наших сообщенных дифференциально экспрессируемых генов.

    2,5. Аллель-специфическая экспрессия с использованием ASE-TIGAR
    . Для оценки аллель-специфической экспрессии дифференциально экспрессируемых генов пары транскриптов были идентифицированы в пещерных и поверхностных транскриптомах, если они имели одинаковый идентификатор Tribolium castaneum Uniprot. Для данной пары аллелей транскрипты были вручную обрезаны до одинаковой длины на основе идентичности последовательностей (рисунок 2B; дополнительный файл 1).Затем мы использовали программное обеспечение ASE-TIGAR [30] для определения количества транскриптов для каждого аллеля. Программное обеспечение предоставило один файл FASTA, содержащий обрезанные аллели из пещерных и поверхностных транскриптомов, а также считывания парных концов из транскриптомов гибридных эмбрионов MPD4, MPD7 и MPD9. Результатом этого программного обеспечения был файл, содержащий ожидаемое количество фрагментов, картированных ASE-TIGAR, значение FPKM и значение THETA, которое представляло собой предполагаемое количество транскриптов. Мы использовали это значение THETA в качестве показателя экспрессии каждого аллеля.Учитывая, что список генов, выбранных нами для анализа аллель-специфической экспрессии, может быть смещен в сторону генов, которые могут показывать аллель-специфическую экспрессию, мы определили, что важно иметь статистически строгий подход к идентификации генов с истинными аллель-специфическими различиями в экспрессии. Идеальным нулевым распределением для проверки гипотез в этом сценарии было бы распределение всех значений логарифмических изменений для всех пар генов. Однако создание такого набора данных не было ни практичным, ни вычислительным.Вместо этого мы решили смоделировать нулевое распределение, которое представляет внутриаллельную дисперсию, используя значения THETA, рассчитанные для каждого аллеля в каждой реплике (MPD4, MPD7, MPD9). Это нулевое распределение будет сворачивать шум, возникающий из-за технических различий (эффекты партии, ошибки секвенирования и т. Д.) И биологических различий (вариабельность экспрессии генов между образцами, шум экспрессии генов и т. Д.). Мы сгенерировали внутриаллельное нулевое распределение путем сравнения изменений логарифмической кратности между репликациями для всех реплик в пределах данного аллеля, например.g., ген X, репликация 1 поверхностного аллеля по сравнению с геном X, реплика 2 поверхностного аллеля и т. д. с использованием специального скрипта Python. Гены, которые имели THETA = 0 в одном или нескольких повторах одного или нескольких аллелей, были отфильтрованы из анализа. Затем мы сравнили распределения внутриаллельных вариаций для поверхностных аллелей и пещерных аллелей с использованием двухвыборочного теста Колмогорова – Смирнова (K – S) и обнаружили, что эти два распределения были неразличимы (статистика K – S = 0,0289, p-значение = 0,9643). Мы объединили нулевые распределения поверхностных и пещерных аллелей и использовали это общее распределение в качестве нулевого распределения для оценки значимости, также используя двухвыборочный тест Колмогорова – Смирнова (K – S).Для каждой пары аллелей мы сгенерировали распределение логарифмических кратных изменений путем сравнения каждой реплики одного аллеля с каждой репликой другого аллеля, всего девять значений на пару аллелей. Мы использовали двухвыборочный тест K – S, реализованный в пакете Pandas Python, для генерации статистики K – S и p-значения, а затем выполнили процедуру коррекции множественной проверки гипотез Бенджамини – Хохберга (B – H) для этого p- значение с использованием пакета Python Scipy.stats и α = 0,05. Гены, для которых наблюдались значительные различия в логарифмических изменениях на основании этого скорректированного значения p, скорректированного с помощью B – H, были названы генами с истинными аллель-специфическими различиями экспрессии.
    2,6. Осаждение данных

    Все последовательности, проанализированные в этом отчете, были предварительно отправлены в Национальный центр биотехнологической информации, архив считываний секвенирования (идентификатор биопроекта: PRJNA597080).

    Преобразование 155 метров в фут

    Какая длина 155 метров? Как далеко 155 метров в футах? Преобразование 155 м в футы.

    Из АнгстремсентиметрыFathomsFeetFurlongsдюймыКилометрыМикроныМилиМиллиметрыНанометры Морские милиПикометры Ярды

    К АнгстремсентиметрыFathomsFeetFurlongsдюймыКилометрыМикроныМилиМиллиметрыНанометры Морские милиПикометры Ярды

    обменные единицы ↺

    155 Метров =

    508.53018 Ноги

    (округлено до 8 цифр)

    Отобразить результат как NumberFraction (точное значение)

    Метр или метр — это основная единица измерения длины в метрической системе, на которой основываются все остальные единицы длины. Он равен 100 сантиметрам, 1/1000 километра или примерно 39,37 дюйма. Фут — это единица длины, равная ровно 12 дюймов или 0,3048 метра.

    метров в фут Преобразования

    (некоторые результаты округлены)

    м футов
    155,00 508,53
    155,01 508,56
    155,02 508.60
    155,03 508,63
    155.04 508,66
    155,05 508,69
    155,06 508,73
    155,07 508,76
    155,08 508,79
    155,09 508,83
    155,10 508,86
    155,11 508,89
    155,12 508,92
    155,13 508.96
    155,14 508,99
    155,15 509,02
    155,16 509,06
    155,17 509,09
    155,18 509,12
    155,19 509,15
    155,20 509,19
    155,21 509,22
    155,22 509,25
    155.23 509,28
    155,24 509,32
    м футов
    155,25 509,35
    155,26 509,38
    155,27 509,42
    155,28 509,45
    155,29 509.48
    155,30 509,51
    155,31 509,55
    155,32 509,58
    155,33 509,61
    155,34 509,65
    155,35 509,68
    155,36 509,71
    155,37 509,74
    155,38 509,78
    155.39 509,81
    155,40 509,84
    155,41 509,88
    155,42 509,91
    155,43 509,94
    155,44 509,97
    155,45 510,01
    155,46 510,04
    155,47 510,07
    155,48 510.10
    155,49 510,14
    м футов
    155,50 510,17
    155,51 510,20
    155,52 510,24
    155,53 510,27
    155,54 510,30
    155.55 510,33
    155,56 510,37
    155,57 510,40
    155,58 510,43
    155,59 510,47
    155,60 510,50
    155,61 510,53
    155,62 510,56
    155,63 510,60
    155,64 510.63
    155,65 510,66
    155,66 510,70
    155,67 510,73
    155,68 510,76
    155,69 510,79
    155,70 510,83
    155,71 510,86
    155,72 510,89
    155,73 510,93
    155.74 510,96
    м футов
    155,75 510,99
    155,76 511,02
    155,77 511,06
    155,78 511,09
    155,79 511,12
    155,80 511.

    Добавить комментарий

    Ваш адрес email не будет опубликован.

    2022 © Все права защищены.