Gsg 1: Classification of Radioactive Waste | IAEA

Содержание

Брюки тактические GSG-1 черные. Брюки тактические

Для увеличения нажмите на фото

БРЮКИ БСПН  GSG-1 black

Материал: 65% полиэстер, 35%хлопок RipStop
Расцветка: Black
Производитель: Garsing
«Боевые штаны» представляют собой новое поколение тактической одежды.
Штаны  имеют выверенный, тактический дизайн: грамотное расположение карманов, регулировка ширины талии, длинны штанин, настройка прилегания наколенников.
Ткань «рипстоп» (нейлон + хлопок) не выгорает на солнце, рисунок не выстирывается, имеет отличное соотношение таких параметров как вес и прочность.
Для защиты коленных суставов владельца, брюки оснащены интегрированными наколенниками, выполненными в виде пластиковой накладки и демпферного материала (пенки). Регулировка высоты наколенника осуществляется с помощью специального ремешка с утяжкой, расположенного в переднем кармане брюк. Так же можно отрегулировать положение наколенников по горизонтали под размеры и телосложение владельца, что в свою очередь обеспечит дополнительную фиксацию и исключит «сваливание» наколенника по сторонам в моменты активных двигательных нагрузок.

При желании наколенники можно вынуть из брючин, что позволяет легко постирать данные штаны, либо использовать без наколенников. Отверстия для размещения интегрированной защиты закрываются специальной пришитой внутри отверстия вкладкой на «велкро».

Оттенок может отличаться от представленного на фото.


Код позиции Наименование Цена На складе
73597 Брюки тактические GSG-1 черные 2XL 5445.00 1 шт.
73598 Брюки тактические GSG-1 черные 3XL 5445.00 3 шт.
73207 Брюки тактические GSG-1 черные L отсутствует
73208 Брюки тактические GSG-1 черные M 5445.00 2 шт.
73599 Брюки тактические GSG-1 черные S
отсутствует
73209 Брюки тактические GSG-1 черные XL отсутствует

Брюки тактические Garsing «БСПН» Olive GSG-1

Брюки тактические специального назначения БСПН Olive.

Данная модель штанов имеет выверенный дизайн, грамотное расположение карманов, регулировку ширины пояса талии и длины штанин, настройку прилегания наколенников, а также усиления из нейлона в местах наибольшей нагрузки.

Изготовлены из ткани смесовой ткани рип-стоп (65 полиэстр 35% хлопок).

Ткань не выгорает на солнце, рисунок не выстирывается.

Ее отличает прекрасное соотношение прочность/вес.

За счёт упрочняющих нитей мелкие порезы и дырки не могут свободно разойтись на такой ткани.

Брюки застегиваются на качественную молнию YKK и канадскую пуговицу, которая обладает способностью выдерживать значительные шоковые физические нагрузки. Ее еще часто называют «неотрывной».

В районе пояса ширина брюк регулируется липучкой «велкро».

На поясе имеются широкие шлёвки для ремня.

Спереди и сзади брюк — по 2 достаточно объемных врезных кармана. Задние карманы застегиваются на «молнию».

Передние накладные карманы достаточно объемные. В них размещается регулировка коленей по высоте. Кроме этого в них есть резинки, с помощью которых можно зафиксировать фонарик, пистолетный магазин или лоадер.

Два накладных объемных боковых кармана для удобства немного смещены назад. Над боковыми карманами есть небольшой сквозной кармашек для фонарика, ножа, или ручки.

В районе колен предусмотрена интегрированная защита из пластика, которую, при желании, можно снять. Крепится защита коленей липучкой «велкро».

Места крепления наколенников закрываются специальной вкладкой на липучке «велкро».

Брюки в районе колен регулируются как по высоте, так и ширине. Регулировка по ширине осуществляется с помощью двух утяжек на «велкро».

Внизу есть небольшие карманы для индивидуального перевязочного пакета или жгута с резинками внутри.

По бокам штанин есть вентиляция на «молнии». Клапан вентиляции закрыт сеткой.

На лодыжке есть регулировка по ширине на «велкро». Место где штанина чаще всего трется усилено вставкой из кордуры.

Брюки Garsing тактические #GSG-1 черные

Интернет-магазин: Нет в наличии

Новосибирск, пр-т Строителей, 19: Нет в наличии

Новосибирск, ул. Нарымская, 23: Нет в наличии

Новосибирск, ул. Мичурина, 12: Нет в наличии

Бердск, ул. Первомайская, 1/1: Нет в наличии

Бердск, ул. Карла Маркса, 1: Нет в наличии

Искитим, ул. Станционная, 1б (ЖУМ): Нет в наличии

Черепаново, ул. Республиканская, 61: Нет в наличии

Барнаул, ул. Взлетная, 2к: Нет в наличии

Бийск, ул. Больничный взвоз, 8: В наличии

Майма, ул. Подгорная, 37: В наличии

Куйбышев, ул. Чехова, 18: Нет в наличии

Интернет-магазин: Нет в наличии

Новосибирск, пр-т Строителей, 19: Нет в наличии

Новосибирск, ул. Нарымская, 23: Нет в наличии

Новосибирск, ул. Мичурина, 12: Нет в наличии

Бердск, ул. Первомайская, 1/1: Нет в наличии

Бердск, ул. Карла Маркса, 1: Нет в наличии

Искитим, ул. Станционная, 1б (ЖУМ): Нет в наличии

Черепаново, ул. Республиканская, 61: Нет в наличии

Барнаул, ул. Взлетная, 2к: Нет в наличии

Бийск, ул. Больничный взвоз, 8: В наличии

Майма, ул. Подгорная, 37: В наличии

Куйбышев, ул. Чехова, 18: Нет в наличии

Интернет-магазин: В наличии

Новосибирск, пр-т Строителей, 19: Нет в наличии

Новосибирск, ул. Нарымская, 23: Нет в наличии

Новосибирск, ул. Мичурина, 12: Нет в наличии

Бердск, ул. Первомайская, 1/1: Нет в наличии

Бердск, ул. Карла Маркса, 1: Нет в наличии

Искитим, ул. Станционная, 1б (ЖУМ): Нет в наличии

Черепаново, ул. Республиканская, 61: Нет в наличии

Барнаул, ул. Взлетная, 2к: Нет в наличии

Бийск, ул. Больничный взвоз, 8: В наличии

Майма, ул. Подгорная, 37: Нет в наличии

Куйбышев, ул. Чехова, 18: Нет в наличии

GSG1 — Белок гена 1, специфичный для зародышевых клеток — Homo sapiens (Human)

В этом подразделе раздела Последовательность указывается, что

каноническая последовательность , отображаемая по умолчанию в записи, является полной или нет.

Подробнее. ..

Статус последовательности i : Завершено.

.

Эта запись содержит 8 описанных изоформ и 5 потенциальных изоформ, которые сопоставлены с помощью вычислений. Показать все Выровнять все

Добавить BLAST
Функциональный ключ Позиция (я) Описание Действия Графическое представление Длина

В этом подразделе раздела «Последовательность» сообщается о различиях между канонической последовательностью (отображаемой по умолчанию в записи) и различными отправленными последовательностями, объединенными в записи.Эти различные материалы могут происходить из разных проектов секвенирования, разных типов экспериментов или разных биологических образцов. Конфликты последовательностей обычно имеют неизвестное происхождение.

Подробнее …

Конфликт последовательностей i
32 S → P в BAC11548 (PubMed: 14702039). 1
Конфликт последовательностей i 259 M → V в BAC11540 (PubMed: 14702039). 1
Функциональный ключ Позиция (я) Описание Действия Графический вид Длина

В этом подразделе раздела «Последовательность» описываются природные варианты белковой последовательности.

Подробнее … < / p> Естественный вариант i VAR_042684
39 F → L

Информация, подобранная вручную, для которой опубликованы экспериментальные данные.

Дополнительно…

Ручное утверждение на основе эксперимента в i

Соответствует варианту dbSNP: rs2306765Ensembl.
1
Естественный вариант i VAR_042685 67 G → V. Соответствует варианту dbSNP: rs11546332Ensembl. 1
Функциональный ключ Положение (я) Описание Действия Графический вид
Длина

В этом подразделе раздела «Последовательность» описывается последовательность встречающейся в природе альтернативной изоформы (ов) белка.Изменения в аминокислотной последовательности могут быть связаны с альтернативным сплайсингом, использованием альтернативного промотора, альтернативной инициацией или рибосомным сдвигом рамки.

Подробнее …

Альтернативная последовательность i VSP_032992
1-3 MAK → MSDPSQLTQNVCLTQE в изоформе 6 и изоформе 7.

Информация, подобранная вручную, основанная на утверждениях в научных статьях, не подтвержденных экспериментально.

Дополнительно …

Ручное утверждение, основанное на мнении в i

  • «Полное секвенирование и характеристика 21 243 полноразмерных кДНК человека».
    Ота Т., Судзуки Ю., Нисикава Т., Оцуки Т., Сугияма Т., Ирие Р., Вакамацу А., Хаяси К., Сато Х., Нагаи К., Кимура К., Макита Х., Секин М., Обаяси М., Ниси Т., Шибахара Т., Танака Т., Ishii S., Yamamoto J., Saito K., Kawai Y., Isono Y., Nakamura Y., Nagahari K., Murakami K., Yasuda T., Iwayanagi T., Wagatsuma M., Shiratori A., Sudo Х., Хосойри Т., Каку Й., Кодайра Х., Кондо Х., Сугавара М., Такахаши М., Канда К., Йокои Т., Фуруя Т., Киккава Э., Омура Ю., Абе К. , Камихара К., Кацута Н., Сато К., Таникава М., Ямадзаки М., Ниномия К., Исибаши Т., Ямасита Х., Муракава К., Фудзимори К., Танай Х., Кимата М., Ватанабэ М., Хираока С., Чиба Ю., Исида С., Оно Ю., Такигучи С., Ватанабэ С., Йосида М., Хотута Т., Кусано Дж., Канехори К., Такахаши-Фуджи А., Хара Х., Танасе Т.-О., Номура Ю., Тогия С., Комай Ф., Хара Р., Такеучи К., Арита М., Имосе Н., Мусасино К., Юки Х., Осима А., Сасаки Н., Аотсука С., Йошикава Ю., Мацунава Х., Итихара Т., Шиохата Н. ., Сано С., Мория С., Момияма Х., Сато Н., Таками С., Терашима Ю., Судзуки О., Накагава С., Сено А., Мидзогути Х., Гото Ю., Симидзу Ф., Вакебе Х., Хисигаки Х., Ватанабэ Т., Сугияма А., Такемото М., Каваками Б., Ямазаки М., Ватанабе К., Кумагаи А., Итакура С., Фукузуми Ю., Фудзимори Ю., Комияма М., Таширо Х., Танигами А., Фудзивара Т., Оно Т., Ямада К., Фуджи Y., Ozaki K., Hirao M., Ohmori Y., Kawabata A., Hikiji T., Kobatake N., Inagaki H., Ikema Y., Okamoto S., Okitani R., Kawakami T., Noguchi S. , Ито Т., Шигета К., Сенба Т., Мацумура К., Накадзима Ю., Мидзуно Т., Моринага М.
    , Сасаки М., Тогаши Т., Ояма М., Хата Х., Ватанабэ М., Комацу Т., Мидзусима-Сугано Дж., Сато Т., Шираи Ю., Такахаши Ю., Накагава К., Окумура К., Нагасе Т., Номура Н., Кикучи Х., Масухо Ю., Ямасита Р., Накай К., Яда Т., Накамура Ю., Охара О., Исогай Т., Сугано С.
    Нат . Genet. 36: 40-45 (2004) [PubMed] [Europe PMC] [Реферат]

    Цитируется для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ МРНК] (ISOFORMS 3; 4; 5; 7 И 8).

  • Процитировано для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ MRNA] (ИЗОФОРМЫ 2; 4 И 6), ВАРИАНТ LEU-39.

3
Альтернативная последовательность i VSP_032993 109-113 Отсутствует в изоформе 3, изоформе 4, изоформе 5, изоформе 6 и изоформе 8.

Ручное утверждение, основанное на мнении в i

  • «Инициатива по открытию секретируемого белка (SPDI), широкомасштабная попытка идентифицировать новые секретируемые и трансмембранные белки человека: биоинформатическая оценка».
    Кларк Х.Ф., Герни А.Л., Абая Э., Бейкер К., Болдуин Д.Т., Браш Дж., Чен Дж., Чоу Б., Чуи К., Кроули К., Каррелл Б., Деуэл Б., Дауд П. , Eaton D., Foster JS, Grimaldi C., Gu Q., Hass PE , Хелденс С., Хуанг А., Ким Х.С., Климовски Л., Jin Y., Johnson S., Lee J., Lewis L., Liao D., Mark MR, Robbie E., Sanchez C., Schoenfeld J., Seshagiri S., Simmons L., Singh J., Smith V. ., Стинсон Дж., Вагтс А., Вандлен Р.Л., Ватанабэ К., Вианд Д., Вудс К., Се М.-Х., Янсура Д.Г., Йи С., Ю Г., Юань Дж., Чжан М. , Чжан З., Годдард А.Д., Вуд В.И., Годовски П.Дж., Грей А.М.
    Genome Res. 13: 2265-2270 (2003) [PubMed] [Europe PMC] [Резюме]

    Цитируется по: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [МРНК в большом масштабе] (ISOFORM 4).

  • «Полное секвенирование и характеристика 21 243 полноразмерных кДНК человека. «
    Ота Т., Судзуки Ю., Нисикава Т., Оцуки Т., Сугияма Т., Ирие Р., Вакамацу А., Хаяси К., Сато Х., Нагаи К., Кимура К., Макита Х. , Секин М., Обаяси М., Ниси Т., Шибахара Т., Танака Т., Исии С., Ямамото Дж., Сайто К., Кавай Ю., Исоно Ю., Накамура Ю., Нагахари К., Мураками K., Yasuda T., Iwayanagi T., Wagatsuma M., Shiratori A., Sudo H., Hosoiri T., Kaku Y., Kodaira H., Kondo H., Sugawara M., Takahashi M., Kanda K. , Ёкои Т., Фуруя Т., Киккава Э., Омура Ю., Абэ К., Камихара К., Кацута Н., Сато К., Таникава М., Ямадзаки М., Ниномия К., Исибаши Т., Ямасита Х., Муракава К., Фудзимори К., Танай Х., Кимата М., Ватанабэ М., Хираока С., Чиба Ю., Исида С., Оно Ю., Такигучи С., Ватанабэ С., Йосида М., Хотута Т., Кусано Дж., Канехори К., Такахаши-Фуджи А., Хара Х., Танасе Т.-О., Номура Ю., Тогия С., Комай Ф., Хара Р., Такеучи К., Арита М., Имосе Н., Мусасино К., Юки Х., Осима А., Сасаки Н., Аотсука С., Йошикава Ю., Мацунава Х., Итихара Т., Шиохата Н., Сано С., Мория С., Момияма Х., Сато Н., Таками С., Терашима Й., Судзуки О., Накагава С., Сено А., Мидзогути Х., Гото Й., Симидзу Ф., Вакебе Х., Хишигаки Х., Ватанабэ Т., Сугияма А., Такемото М., Каваками Б., Ямадзаки М., Ватанабе К., Кумагаи А., Итакура С., Фукузуми Ю., Фудзимори Ю., Комияма М., Таширо Х., Танигами А. , Fujiwara T., Ono T., Yamada K., Fujii Y., Ozaki K., Hirao M., Ohmori Y., Kawabata A., Hikiji T., Kobatake N., Inagaki H., Ikema Y., Okamoto С., Окитани Р., Каваками Т., Ногучи С., Ито Т., Сигета К., Сенба Т., Мацумура К., Накадзима Ю., Мидзуно Т., Моринага М., Сасаки М., Тогаши Т., Ояма М., Хата Х., Ватанабэ М., Комацу Т., Мидзусима-Сугано Дж. , Сато Т., Шираи Ю., Такахаши Ю., Накагава К., Окумура К., Нагасе Т., Номура Н., Кикучи Х., Масухо Ю., Ямасита Р., Накай К., Яда Т., Накамура Ю., Охара О., Исогай Т., Сугано С.
    Nat. Genet. 36: 40-45 (2004) [PubMed] [Europe PMC] [Реферат]

    Цитируется для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ МРНК] (ISOFORMS 3; 4; 5; 7 И 8).

  • Процитировано для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ MRNA] (ИЗОФОРМЫ 2; 4 И 6), ВАРИАНТ LEU-39.

Добавить BLAST
23
Альтернативная последовательность я VSP_032994 148 — 349 EILWL … EEEQC → GEKGLLEFATLQGPCHPTLR FGGKRLMEKASLPSPPLGLC GKNPMVIPGNADHLHRTSIH QLPPATNRLATHWEPCLWAQ TERLCCCFLCPVRSPGDGGP HDVFTSLPSDCQLGSRRLET TCLELWLGLLHGLALLHLLH GVGCHHLQHVHQDGAGVQVQ А на изоформы 4.

Руководство утверждение основано на мнении in i

  • «Инициатива по открытию секретных белков (SPDI), широкомасштабная попытка идентифицировать новые секретируемые и трансмембранные белки человека: оценка биоинформатики.»
    Кларк Х.Ф., Герни А.Л., Абая Э., Бейкер К., Болдуин Д.Т., Браш Дж., Чен Дж., Чоу Б., Чуи К., Кроули К., Керрелл Б., Деуэл Б., Дауд П. ., Итон Д., Фостер Дж. С., Гримальди К., Гу К., Хасс П. Е., Хелденс С., Хуанг А., Ким Х. С., Климовски Л., Джин Ю., Джонсон С., Ли Дж., Льюис Л. , Liao D., Mark MR, Robbie E., Sanchez C., Schoenfeld J., Seshagiri S., Simmons L., Singh J., Smith V., Stinson J., Vagts A., Vandlen RL, Watanabe C. , Вианд Д., Вудс К., Се М.-Х., Янсура Д.Г., Йи С., Ю.Г., Юань Дж., Чжан М., Чжан З., Годдард А.Д., Вуд В.И., Годовски П.Дж., Грей А.М.
    Genome Res. 13: 2265-2270 (2003) [PubMed] [Europe PMC] [Резюме]

    Цитируется по: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [МРНК в большом масштабе] (ISOFORM 4).

  • «Полное секвенирование и характеристика 21 243 полноразмерных кДНК человека».
    Ота Т., Судзуки Ю., Нисикава Т., Оцуки Т., Сугияма Т., Ирие Р., Вакамацу А., Хаяси К., Сато Х., Нагаи К., Кимура К., Макита Х., Секинэ М., Обаяси М., Ниси Т., Шибахара Т., Танака Т., Исии С., Ямамото Дж., Сайто К., Кавай Ю., Исоно Ю., Накамура Ю., Нагахари К., Мураками К., Ясуда Т., Иваянаги Т., Вагацума М., Сиратори А., Судо Х., Хосойри Т., Каку Й., Кодайра Х. , Кондо Х., Сугавара М., Такахаши М., Канда К., Ёкои Т., Фуруя Т. , Киккава Э., Омура Ю., Абэ К., Камихара К., Кацута Н., Сато К., Таникава М., Ямадзаки М., Ниномия К., Ишибаши Т., Ямасита Х., Муракава К., Фудзимори К., Танай Х., Кимата М., Ватанабэ М., Хираока С., Чиба Ю., Исида С., Оно Ю., Такигучи С., Ватанабэ С., Йосида М., Хотута Т., Кусано Дж., Канехори К., Такахаши-Фуджи А., Хара Х., Танасе Т.-О., Номура Ю., Тогия С., Комай Ф., Хара Р., Такеучи К., Арита М., Имосе Н., Мусасино К., Юки Х., Осима А., Сасаки Н., Аотсука С., Йошикава Ю. ., Мацунава Х., Итихара Т., Шиохата Н., Сано С., Мория С., Момияма Х., Сато Н., Таками С., Терасима Ю., Судзуки О., Накагава С., Сено А., Мидзогути Х., Гото Ю., Симидзу Ф., Вакебе Х., Хишигаки Х., Ватанабэ Т., Сугияма А., Такемото М., Каваками Б., Ямазаки М., Ватанабе К., Кумагаи А., Итакура С., Фукузуми Ю., Фудзимори Ю., Комияма М., Таширо Х., Танигами А., Фудзивара Т., Оно T., Yamada K., Fujii Y., Ozaki K., Hirao M., Ohmori Y., Kawabata A., Hikiji T., Kobatake N., Inagaki H., Ikema Y., Okamoto S., Okitani R. , Каваками Т., Ногучи С., Ито Т., Сигета К., Сенба Т., Мацумура К., Накадзима Ю., Мизуно Т., Моринага М., Сасаки М., Тогаши Т., Ояма М., Хата Х., Ватанабэ М., Комацу Т., Мидзусима-Сугано Дж., Сато Т., Шираи Ю., Такахаши Ю., Накагава К., Окумура К., Нагасе Т., Номура Н., Кикучи Х., Масухо Ю., Ямасита Р., Накай К., Яда Т., Накамура Ю., Охара О., Исогай Т., Сугано С.
    Nat. Genet. 36: 40-45 (2004) [PubMed] [Europe PMC] [Реферат]

    Цитируется для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ МРНК] (ISOFORMS 3; 4; 5; 7 И 8).

  • Процитировано для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ MRNA] (ИЗОФОРМЫ 2; 4 И 6), ВАРИАНТ LEU-39.

Добавить BLAST
202
Альтернативная последовательность я VSP_032995 148 — 349 EILWL . .. EEEQC → GEKGLLEFATLQGPCHPTLR FGGKRLMEKASLPSPPLGLC GKNPMVIPGNADHLHRTSIH QLPPATNRLATHWEPCLWAQ TERLCCCFLCPVRSPGDGGP HDVFTSLPSDCQLGSRRLET TCLELWLGLLHGLALLHLLH GVGCHHLQHVHQDGAGVQVQ PPPWVL в изоформы 7.

Ручное утверждение, основанное на мнении в i

  • «Полное секвенирование и характеристика 21 243 полноразмерных кДНК человека».
    Ота Т., Судзуки Ю., Нисикава Т., Оцуки Т., Сугияма Т., Ирие Р., Вакамацу А., Хаяси К., Сато Х., Нагаи К., Кимура К., Макита Х., Секин М., Обаяси М., Ниси Т., Шибахара Т., Танака Т., Исии С., Ямамото Дж., Сайто К., Кавай Ю., Исоно Ю., Накамура Ю., Нагахари К., Мураками К. ., Ясуда Т., Иваянаги Т., Вагацума М., Ширатори А., Судо Х., Хосойри Т., Каку Й., Кодайра Х., Кондо Х., Сугавара М., Такахаши М., Канда К., Йокои Т., Фуруя Т., Киккава Э., Омура Ю., Абе К., Камихара К., Кацута Н., Сато К., Таникава М., Ямадзаки М., Ниномия К., Исибаши Т., Ямасита Х., Муракава К., Фудзимори К., Танай Х. , Кимата М., Ватанабэ М., Хираока С., Чиба И., Исида С., Оно Ю., Такигучи С., Ватанабэ С., Йосида М., Хотута Т., Кусано Дж., Канехори К., Такахаши -Fujii A., Hara H., Tanase T.-O., Nomura Y., Togiya S., Komai F., Хара Р., Такеучи К., Арита М., Имосе Н., Мусасино К., Юки Х., Осима А., Сасаки Н., Аотсука С., Йошикава Ю., Мацунава Х., Итихара Т., Шиохата Н., Сано С., Мория С., Момияма Х., Сато Н., Таками С., Терашима Ю., Судзуки О., Накагава С., Сено А., Мидзогути Х., Гото Ю., Симидзу Ф. , Вакебе Х., Хисигаки Х., Ватанабе Т., Сугияма А., Такемото М., Каваками Б., Ямадзаки М., Ватанабе К., Кумагаи А., Итакура С., Фукузуми Ю., Фудзимори Ю., Комияма М., Таширо Х., Танигами А., Фудзивара Т., Оно Т., Ямада К., Фудзи Ю., Одзаки К., Хирао М., Омори Ю., Кавабата А., Хикиджи Т., Кобатаке Н., Инагаки Х., Икема Ю., Окамото С., Окитани Р., Каваками Т., Ногучи С., Ито Т., Сигета К., Сенба Т., Мацумура К., Накадзима Ю., Мидзуно Т., Моринага М., Сасаки М., Тогаши Т., Ояма М., Хата Х. , Ватанабэ М., Комацу Т., Мидзусима-Сугано Дж. , Сато Т., Шираи Ю., Такахаши Ю., Накагава К., Окумура К., Нагасе Т., Номура Н., Кикучи Х., Масухо Ю. , Ямасита Р., Накай К., Яда Т., Накамура Ю., Охара О., Исогай Т., Sugano S.
    Nat. Genet. 36: 40-45 (2004) [PubMed] [Europe PMC] [Реферат]

    Цитируется для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ МРНК] (ISOFORMS 3; 4; 5; 7 И 8).

202
Альтернативная последовательность я VSP_032996 148 — 280 EILWL … NCLPH → GEKGLLEFATLQGPCHPTLR FGGKRLMEKASLPSPPLGLC GKNPMVIPGNADHLHRTSTH QLPPATNRLATHWEPCLWAQ TERLCCCFLCPVRSPGDGGP HDVFTSLPSDCQLGSRRLET TCLELWLGLLHGLALLHLLH GVGCHHLQHV в изоформы 8.

Ручное утверждение, основанное на мнении в i

  • «Полное секвенирование и характеристика 21 243 полноразмерных кДНК человека».
    Ота Т., Судзуки Ю., Нисикава Т., Оцуки Т., Сугияма Т., Ирие Р., Вакамацу А., Хаяси К., Сато Х., Нагаи К., Кимура К., Макита Х., Секин М., Обаяси М., Ниси Т., Шибахара Т., Танака Т., Исии С., Ямамото Дж., Сайто К., Кавай Ю., Исоно Ю., Накамура Ю., Нагахари К., Мураками К. ., Ясуда Т., Иваянаги Т., Вагацума М., Ширатори А., Судо Х., Хосойри Т., Каку Й., Кодайра Х., Кондо Х., Сугавара М., Такахаши М., Канда К., Йокои Т., Фуруя Т., Киккава Э., Омура Ю., Абе К., Камихара К., Кацута Н., Сато К., Таникава М., Ямадзаки М., Ниномия К., Исибаши Т., Ямасита Х., Муракава К., Фудзимори К., Танай Х. , Кимата М., Ватанабэ М., Хираока С., Чиба И., Исида С., Оно Ю., Такигучи С., Ватанабэ С., Йосида М., Хотута Т., Кусано Дж., Канехори К., Такахаши -Fujii A., Hara H., Tanase T.-O., Nomura Y., Togiya S., Komai F., Хара Р., Такеучи К., Арита М., Имосе Н., Мусасино К., Юки Х., Осима А., Сасаки Н., Аотсука С., Йошикава Ю., Мацунава Х., Итихара Т., Шиохата Н., Сано С., Мория С., Момияма Х., Сато Н. , Таками С., Терашима Ю., Судзуки О., Накагава С., Сено А., Мидзогути Х., Гото Ю., Симидзу Ф. , Вакебе Х., Хисигаки Х., Ватанабе Т., Сугияма А., Такемото М., Каваками Б., Ямадзаки М., Ватанабе К., Кумагаи А., Итакура С., Фукузуми Ю., Фудзимори Ю., Комияма М., Таширо Х., Танигами А., Фудзивара Т., Оно Т., Ямада К., Фудзи Ю., Одзаки К., Хирао М., Омори Ю., Кавабата А., Хикиджи Т., Кобатаке Н., Инагаки Х., Икема Ю., Окамото С., Окитани Р., Каваками Т., Ногучи С., Ито Т., Сигета К., Сенба Т., Мацумура К., Накадзима Ю., Мидзуно Т., Моринага М., Сасаки М., Тогаши Т., Ояма М., Хата Х. , Ватанабэ М., Комацу Т., Мидзусима-Сугано Дж., Сато Т., Шираи Ю., Такахаши Ю., Накагава К., Окумура К., Нагасе Т., Номура Н., Кикучи Х., Масухо Ю. , Ямасита Р., Накай К., Яда Т., Накамура Ю., Охара О., Исогай Т., Sugano S.
    Nat. Genet. 36: 40-45 (2004) [PubMed] [Europe PMC] [Реферат]

    Цитируется для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ МРНК] (ISOFORMS 3; 4; 5; 7 И 8).

Добавить BLAST
133
Альтернативная последовательность i VSP_032997 148 — 198 Отсутствует в изоформе 2 и изоформе 5.

Утверждение вручную на основе заключения в i

    901 Полное секвенирование и характеристика 21 243 полноразмерных кДНК человека.»
    Ота Т., Судзуки Ю., Нисикава Т., Оцуки Т., Сугияма Т., Ирие Р., Вакамацу А., Хаяси К., Сато Х., Нагаи К., Кимура К., Макита Х. , Секин М., Обаяси М., Ниси Т., Шибахара Т., Танака Т., Исии С., Ямамото Дж., Сайто К., Кавай Ю., Исоно Ю., Накамура Ю., Нагахари К., Мураками K., Yasuda T., Iwayanagi T., Wagatsuma M., Shiratori A., Sudo H., Hosoiri T., Kaku Y., Kodaira H., Kondo H., Sugawara M., Takahashi M., Kanda K. , Ёкои Т., Фуруя Т., Киккава Э., Омура Ю., Абэ К., Камихара К., Кацута Н., Сато К., Таникава М., Ямадзаки М., Ниномия К. , Исибаши Т., Ямасита Х., Муракава К., Фудзимори К., Танай Х., Кимата М., Ватанабэ М., Хираока С., Чиба Ю., Исида С., Оно Ю., Такигучи С., Ватанабэ С., Йосида М., Хотута Т., Кусано Дж., Канехори К., Такахаши-Фуджи А., Хара Х., Танасе Т.-О., Номура Ю., Тогия С., Комай Ф., Хара Р., Такеучи К., Арита М., Имосе Н., Мусасино К., Юки Х., Осима А., Сасаки Н., Аотсука С., Йошикава Ю., Мацунава Х., Итихара Т., Шиохата Н., Сано С., Мория С., Момияма Х., Сато Н., Таками С., Терашима Й., Судзуки О., Накагава С., Сено А., Мидзогути Х., Гото Й., Симидзу Ф., Вакебе Х., Хишигаки Х., Ватанабэ Т., Сугияма А., Такемото М., Каваками Б., Ямадзаки М., Ватанабе К., Кумагаи А., Итакура С., Фукузуми Ю., Фудзимори Ю., Комияма М., Таширо Х., Танигами А. , Fujiwara T., Ono T., Yamada K., Fujii Y., Ozaki K., Hirao M., Ohmori Y., Kawabata A., Hikiji T., Kobatake N., Inagaki H., Ikema Y., Okamoto С., Окитани Р., Каваками Т., Ногучи С., Ито Т., Сигета К., Сенба Т., Мацумура К., Накадзима Ю., Мидзуно Т., Моринага М., Сасаки М., Тогаши Т., Ояма М., Хата Х., Ватанабэ М., Комацу Т., Мидзусима-Сугано Дж. , Сато Т., Шираи Ю., Такахаши Ю., Накагава К., Окумура К., Нагасе Т., Номура Н., Кикучи Х., Масухо Ю., Ямасита Р., Накай К., Яда Т., Накамура Ю., Охара О., Исогай Т., Сугано С.
    Nat. Genet. 36: 40-45 (2004) [PubMed] [Europe PMC] [Реферат]

    Цитируется для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ МРНК] (ISOFORMS 3; 4; 5; 7 И 8).

  • Процитировано для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ MRNA] (ИЗОФОРМЫ 2; 4 И 6), ВАРИАНТ LEU-39.

Добавить BLAST
51

American Tactical Inc.

СЕЙЧАС В НАЛИЧИИ!

Новинка 2019 года — винтовка GSG-16 .22lr! Эта легкая тактическая винтовка калибра .22lr — воплощение мечты любого мастера! Основанная на классической операционной системе винтовки GSG 22 калибра, GSG-16 имеет несколько усовершенствований, которые придают ей новый лихой вид для стрелков следующего поколения. GSG-16 имеет складную ложу новой конструкции, которая также служит дополнительным отсеком для хранения магазинов большой или малой емкости. Обновленное цевье оснащено стандартными планками Пикатинни, установленными на ручную защиту в стиле MLOK. Трубка взвода оснащена двусторонней рукояткой для зарядки, поэтому вы можете переключать зарядные патроны в соответствии со своим стилем комфорта. Наконец, переработанная мушка и целик были упрощены и модернизированы, чтобы стрелок быстрее обнаруживал цель по сравнению с предыдущими моделями GSG.Начинаете ли вы с нуля или отряхиваете пыль со своих старых журналов GSG, чтобы снизить дальность стрельбы, GSG-16 — это забавное и доступное ружье калибра .22lr, которое сегодня заслуживает место в вашей коллекции!

Особенности:

— .22LR (рекомендуется высокая скорость, рекомендуется 1260 кадров в секунду)

— 34 1/4 «Общая длина с полностью выдвинутым прикладом

— 28 1/2 «Общая длина с полностью сложенным прикладом

— Ствол 16 1/4 «6 канавок

— 5.84 фунта без патронов

— Триггер

5,5 фунтов

— Складной приклад с дополнительным отделением для хранения журналов

— Магазин на 22 раунда (работает с ручными и поворотными магазинами GSG-5/522)

— Рукоятка для зарядки для обеих рук

— Прицел с быстрым захватом

— Искусственный подавитель

— планки Пикатинни на цевье МЛОК

— Ресивер полимерный

* GSG-16 поставляется с 1 магазином.Дополнительные магазины можно приобрести отдельно

Ограниченная пожизненная гарантия и политика возврата продукта. Для получения дополнительной информации щелкните ссылку:
http://www.americantactical.us/warranty.html

Доступно у дилеров ATI Stocking:
http://www.americantactical.us/stockingdealer

Или найдите ближайшего к вам местного дилера:
http://www.americantactical. us/catalyst.aspx?st=80000&e=dealeroptions

Просматривайте руководства и изображения в разобранном виде на вкладке «Загрузки»:
http: // www.americantactical.us/public/files/Manuals/Firefly%20ManualUpload_compressed.pdf

Рекомендуемые боеприпасы:

  • Используйте только боеприпасы коммерческого класса в оригинальной упаковке, соответствующей калибру оружия. На пистолете указан правильный калибр.
  • 22LR (длинная винтовка) High Velocity (HV) с минимум 1260 футов в секунду (FPS) 36-40 гран.
  • Никогда не используйте перезаряженные, «восстановленные», заряженные вручную или нестандартные боеприпасы другого калибра.
  • Никогда не используйте грязные, влажные, ржавые, погнутые, поврежденные или смазанные маслом боеприпасы.
  • К сожалению, настроить полуавтоматический пистолет на все нагрузки невозможно.
0 Обзоры

Нажмите здесь чтобы написать отзыв.

Значение для регуляции миелинизации

  1. ШОН П. РАЙДЕР и
  2. ДЖЕЙМС Р.УИЛЬЯМСОН
  1. Департамент молекулярной биологии, Департамент химии, и Институт химической биологии имени Скэггса, Исследование Скриппса Институт, Ла-Хойя, Калифорния , США

Абстрактные

Неадекватное образование и поддержание миелина является основой нескольких нейродегенеративных заболеваний, включая лейкодистрофию. и рассеянный склероз.У мышей для дифференцировки олигодендроцитов и последующего образования миелина требуется ген Quaking . Мутация этого гена приводит к гибели эмбрионов или дрожащему фенотипу, характерному для дисмиелинизации. Quaking кодирует Qk1, член высококонсервативного семейства РНК-связывающих белков STAR / GSG, которые функционируют в качестве основных онтогенетических белков. регуляторы у высших эукариот. Qk1 участвует в регуляции альтернативного сплайсинга, стабильности и трансляции. контроль мРНК, которые кодируют структурные компоненты миелина в глиальных клетках.Мы использовали количественный сдвиг подвижности геля и флуоресцентные поляризационные анализы для определения специфичности нуклеотидной последовательности домена Qk1 STAR / GSG и для зондирования взаимодействие между Qk1 и 3′-нетранслируемой областью (UTR) мРНК основного белка миелина (MBP). Результаты показывают, что Qk1 распознает гексануклеотидный консенсусный элемент, который похож, но не идентичен распознаваемой детерминанте специфичности Caenorhabditis elegans STAR / GSG белок GLD-1.Несколько консенсусных сайтов присутствуют в 3′-UTR мРНК MBP. Сайт с наивысшим соответствием расположен в пределах области локализации РНК, предполагая возможную роль Qk1 в ограничении мРНК MBP миелиновым компартментом.

ВВЕДЕНИЕ

Посттранскрипционная регуляция экспрессии генов играет фундаментальную роль во временном и пространственном развитии центральная нервная система (CNS; Perrone-Bizzozero and Bolognani 2002; Richter and Lorenz 2002).Паттерн сплайсинга, субклеточная локализация, стабильность и эффективность трансляции различных мРНК контролируются. отдельным набором специфичных для ЦНС РНК-связывающих белков. Подчеркивая важность посттранскрипционного контроля в ЦНС, несколько хорошо охарактеризованных неврологических расстройств являются результатом неправильной регуляции активности РНК-связывающего белка. К ним относятся синдром ломкой Х-хромосомы, распространенная форма наследственной умственной отсталости, которая возникает в результате подавления белка домена KH FMRP (Эшли и др.1993), и паранеопластический энцефаломиелит (PEM), аутоиммунное заболевание, связанное с мелкоклеточной карциномой легких, при котором антитела пересекают гематоэнцефалический барьер и инактивируют семейство белков домена ELAV-подобных RRM (Szabo et al. 1991).

РНК-связывающие белки

также имеют решающее значение для функции глиальных клеток, которые генерируют миелин вокруг аксонов нейронов в развивающаяся нервная система. Белок Qk1 домена STAR / GSG экспрессируется в нейрональных предшественниках и в зрелых глиальных клетках, и может быть детерминантой судьбы глиальных клеток (Hardy et al.1996; Харди 1998b). Три основные альтернативно сплайсированные изоформы продуцируются из гена Quaking , одна из которых содержит С-концевую последовательность ядерной локализации (Рис. 1A; Wu et al. 1999). Мутация, индуцированная этилнитрозомочевиной ( qk kt4 ) в РНК-связывающем домене Qk1, приводит к эмбриональной летальности (Justice and Bode 1988; Chen and Richard 1998). Напротив, жизнеспособная мутация Quaking ( qk v ), состоящая из делеции в вышестоящей регуляторной последовательности, дает фенотип подергивания, подобный мутантам в структурной структуре миелина. компонентов и демонстрирует тяжелую дисмиелинизацию ЦНС (Sidman et al.1964; Эберсол и др. 1996). Поскольку цитоплазматический Qk1 не локализован в миелиновом компартменте, преобладающая гипотеза состоит в том, что Qk1 регулирует экспрессия структурных белков миелина (Hardy et al. 1996; Hardy 1998a).

Эту предложенную роль поддерживает несколько линий доказательств. Во-первых, уровень мРНК основного белка миелина (MBP) снижается у мышей qk v / qk v (Lu et al. 2003).Во-вторых, паттерн субклеточной локализации оставшейся мРНК изменяется таким образом, что в миелиновом компартменте присутствует меньше. и больше РНК сохраняется в ядре (Li et al. 2000; Larocque et al. 2002). В-третьих, паттерн сплайсинга MBP, протеолипидного белка (PLP) и миелин-ассоциированного гликопротеина (MAG) нарушается в Сотрясение мышей (Wu et al. 2002). Наконец, было показано, что Qk1 взаимодействует с 3′-нетранслируемой областью (UTR) мРНК MBP с помощью анализа защиты от РНКазы, коиммунопреципитации, и анализ сдвига электрофоретической подвижности (Li et al.2000; Larocque et al. 2002). Было показано, что два больших фрагмента 3′-UTR связываются с Qk1 (Larocque et al. 2002). Однако конкретные функциональные сайты взаимодействия Qk1 с РНК и его специфичность связывания нуклеотидов остаются неясными.

В предыдущей работе мы охарактеризовали сборку Caenorhabditis elegans STAR / GSG белка GLD-1 с его РНК-мишенью (Ryder et al. 2004). Домен STAR / GSG состоит из канонического домена KH, фланкированного двумя консервативными расширениями, названными Qua1 и Qua2 (Vernet and Artzt 1997).Результаты продемонстрировали, что области KH и Qua2 необходимы для связывания РНК, тогда как оба домена Qua1 необходимы. и достаточно, чтобы опосредовать димеризацию в отсутствие РНК или других клеточных компонентов. Кроме того, GLD-1 связывается с наивысшей сродство к последовательностям РНК, содержащим гексануклеотидную консенсусную последовательность, названную SBE (для связывающего элемента STAR; фиг. 1A). Наконец, каждый протомер димера GLD-1 способен индивидуально распознавать этот консенсус, определяя механизм специфического распознавания РНК GLD-1.

Поскольку Qk1 имеет 56% идентичность последовательности с GLD-1 в домене STAR / GSG, кажется вероятным, что Qk1 связывается с аналогичным детерминант специфичности. Чтобы проверить эту гипотезу, были использованы два направления анализа. Во-первых, мы определили способность Qk1 для связывания с библиотекой РНК-мишеней GLD-1 с использованием количественного сдвига подвижности геля и поляризации флуоресценции. Второй, мы измерили связывание Qk1 с фрагментами 3′-UTR мРНК MBP, ранее участвовавшими в опосредовании регуляции этого ген.Результаты показывают, что Qk1 связывается с тем же консенсусом гексануклеотидов, что и GLD-1. Однако ранговый порядок привязки в рамках консенсуса отличается, причем Qk1 демонстрирует сильное предпочтение остатку аденозина в пятом положении. Пять консенсусных сайтов присутствуют в 3′-UTR MBP, и один из них расположен в пределах ранее определенной локализации РНК. область связывается с Qk1 с очень высоким сродством. Этот результат предполагает, что Qk1 опосредует локализацию мРНК MBP в миелине. отсек.

РЕЗУЛЬТАТЫ

Анализ взаимодействия Qk1 с TGE РНК

C. elegans STAR / GSG домен, белок GLD-1 репрессирует трансляцию tra-2 путем специфического связывания с 28-нуклеотидным элементом последовательности (называемым TGE), присутствующим в 3′-UTR транскрипта мРНК ( Ян и др., 1999). В опубликованном отчете было показано, что Qk1-6 (изоформа размером 6 т.п.н.) функционально заменяет GLD-1 при репрессии репортера. ген, содержащий tra-2 3′-UTR у трансгенных червей (Saccomanno et al.1999). Учитывая этот результат и сильное сходство между GLD-1 и Qk1, казалось вероятным, что Qk1 может также связывать TGE с высокая близость. Чтобы проверить эту гипотезу, константа равновесной диссоциации (K d ) между рекомбинантным очищенным доменом Qk1-STAR и этой РНК была определена двумя независимыми количественными методами: электрофоретическим. анализ сдвига подвижности геля и флуоресценция-поляризация (рис. 1B, C; таблица 1). Сродство Qk1 к РНК TGE каждым методом составляет 44 ± 6 нМ и 52 ± 4 нМ соответственно, что эквивалентно в пределах погрешности.Следовательно, оба анализа могут быть эффективно использованы. для мониторинга белок-РНК взаимодействий в этой системе.

Для сравнения, сродство GLD-1-STAR к РНК TGE составляет 11,4 ± 2 по сдвигу подвижности геля и 22 ± 5 нМ по флуоресценции-поляризации, что в три-четыре раза тайтовее, чем Qk1. Эта разница довольно скромная, соответствующая смене стандартного бесплатного изменение энергии <0,5 ккал / моль.Эти данные согласуются с гипотезой о том, что Qk1 связывается с РНК TGE аналогично с GLD-1, но оставалось определить, сходна ли также специфичность связывания.

Определение специфичности связывания Qk1

В предыдущих усилиях наименьший фрагмент TGE, способный связываться с GLD-1-STAR, был идентифицирован как полусайтовая РНК. с последовательностью 5′-AUCUACUCAUAU-3 ‘(Ryder et al.2004 г.). Эта РНК взаимодействует с GLD-1-STAR почти так же, как полноразмерный TGE, и связывается со стехиометрией белок / РНК 1: 1. Этот Простая, минимальная система была использована для исследования специфичности нуклеотидной последовательности GLD-STAR посредством обширного мутагенеза. Относительная сродство 18 точечных мутаций определяли по сдвигу подвижности конкурентного геля. С помощью этого подхода было показано, что GLD-1 связывает с самым высоким сродством к последовательностям РНК, содержащим гексануклеотидный консенсус 5’-UACU (C / A) A-3 ‘(называемый SBE), и менее хорошо к РНК, содержащей расслабленный консенсус (U> G> C / A) A (C> A) U (C / A> U) A.

Поскольку Qk1 достаточно хорошо связывается с РНК TGE, мы сравнили специфичность нуклеотидной последовательности Qk1 с GLD-1, используя та же библиотека из 18 мутантных последовательностей РНК. Была определена относительная способность каждого мутанта конкурировать с взаимодействием Qk1-TGE. за счет конкуренции флуоресценции-поляризации (рис. 2А). Удивительно, но 12-нуклеотидный фрагмент плохо конкурирует за связывание Qk1-STAR, В 30 раз слабее, чем самоконкурент, с полноразмерной последовательностью TGE (относительная IC 50 TGE / 12-mer = 0.03). Это сильно отличается от GLD-1, в котором 12-мерная РНК связывается вдвое слабее, чем полная 28-нуклеотидная РНК. Последовательность TGE.

Однако две отдельные точечные мутации гексануклеотидного консенсуса восстанавливают высокоаффинное связывание с более короткой РНК. Один из них, C21A, связывается с немного более высокой аффинностью, чем полноразмерный TGE, и в 40 раз прочнее, чем 12-мерный белок дикого типа. фрагмент (относительный IC 50 12-мер / C21A = 41).Другой (C19A) всего в три раза слабее, чем TGE, и в девять раз прочнее, чем фрагмент дикого типа. (относительный IC 50 12-мер / C19A 12-мер = 0,3). Для сравнения, одни и те же мутации (C19A и C21A) имеют ограниченное влияние на взаимодействие с GLD-1-STAR. C19A на самом деле связывается в четыре раза слабее, чем 12-мер дикого типа, тогда как C21A связывается только в два раза сильнее.

Консенсус-сайт связывания для Qk1-STAR может быть получен путем сравнения относительной аффинности каждой отдельной точечной мутации. (Рис.2Б). Детерминантой специфичности для этого белка является 5′-NA (A> C) U (A≫C) A-3 ‘, где N равно любому из четырех оснований. Все мутаций, которые допустимы в рамках ослабленного консенсуса GLD-1-STAR, также согласуются с консенсусом Qk-1-STAR. Однако есть несколько заметных различий в порядке ранжирования отдельных нуклеотидов между консенсусом Qk1-STAR и GLD-1-STAR. последовательности. Во-первых, предпочтение GLD-1-STAR уридину в первой позиции, по-видимому, отсутствует в Qk1.Более того, существует небольшое предпочтение аденозину перед цитидином в третьем положении для Qk1, тогда как для GLD-1 это предпочтение обратный. Наконец, Qk1 с гораздо большей аффинностью связывается с мутантом с аденозином в пятом положении, где GLD-1 одинаково хорошо переносит аденозин или цитидин. Вместе эти результаты показывают, что Qk1 может распознавать последовательности РНК в манера очень похожа на GLD-1, но с некоторыми специфическими отличиями.Однако структурная основа этих предпочтений последовательности не сразу понятно.

Идентификация сайтов связывания Qk1 в 3′-UTR мРНК MBP

Имея в руках консенсус высокого сродства Qk1, мы провели поиск предполагаемых сайтов связывания в пределах 3′-UTR одного, если его родственный мишени, мРНК MBP. Были идентифицированы пять сайтов, соответствующих консенсусной последовательности (фиг. 3A). Два участка расположены проксимальнее друг друга в ранее определенной функциональной области UTR, необходимой для локализации мРНК MBP (Ainger et al.1997), и еще три расположены ближе к 3′-концу UTR. Консенсусные сайты связывания не обнаруживаются в пределах первых 900 нуклеотидов. 3′-UTR.

Для определения относительной аффинности каждого сайта были проведены эксперименты по конкурентному связыванию с 12-нуклеотидными РНК, содержащими каждый предполагаемый сайт с использованием Qk1-STAR, связанного с TGE, в качестве зонда (фиг. 3B, C; таблица 2). Каждый из консенсусных сайтов связывается с Qk1. так же или лучше, чем полусайт TGE.Первый сайт (906–918; пронумерован от 5′-конца 3′-UTR) связывается с самое высокое сродство, равное аффинности точечного мутанта C21A. Третий сайт (1060–1072) связывается со вторым по величине сродством, в семь раз туже, чем у полусайта TGE. Второй и четвертый сайты (923–935, 1273–1285) связываются одинаково хорошо, три- в четыре раза туже, чем у полусайта TGE. Последний сайт (1457–1469) связывается с аффинностью, идентичной полусайту TGE.

Поскольку сайт (906–918) связывается с наивысшим сродством, мы приготовили более длинный вариант мРНК MBP, который содержит этот сайт (рис. 3С). Эта РНК, называемая QSBE (Qk1 STAR-связывающий элемент), идентична по размеру полноразмерному TGE и позиционирует консенсусный гексануклеотид в аналогичном месте относительно к концам 5 ‘и 3’. Сродство этой РНК к Qk1-STAR определяли количественным сдвигом подвижности геля, прямым титрование флуоресценция-поляризация и конкурентная флуоресценция-поляризация (рис.3D, E; Таблица 1). K d для каждого метода составляет 25 ± 4 нМ, 9,7 ± 1 нМ и 12 ± 5 нМ соответственно. Для сравнения, GLD-1 связывается с QSBE в равновесном состоянии. константа диссоциации 50 ± 15 нМ (прямое титрование флуоресценция-поляризация). Пониженное сродство GLD-1 к QSBE составляет вероятно, из-за замены C-на-U в консенсусном сайте и согласуется с его сродством к мутанту U17C полноразмерного TGE РНК. Таким образом, Qk1 связывается с РНК QSBE со сродством, аналогичным сродству GLD-1 к РНК TGE.

Анализ связывания Qk1 с QRE РНК

Ранее были идентифицированы два фрагмента мРНК MBP, которые взаимодействуют с Qk1 (Larocque et al. 2002). При использовании иммунопреципитированного Qk1 из трансфицированных клеток HeLa относительная емкость радиоактивно меченных фрагментов MBP 3′-UTR для взаимодействия с Qk1 определяли с использованием анализа связывания гранул. Один фрагмент (815–1144) содержит первые три консенсуса сайты, в том числе QSBE с высоким сродством.Другой сайт (54–164: названный QRE от Quaking Response Element), однако, расположен ближе к 5′-концу UTR в области, лишенной очевидных консенсусных сайтов связывания. Проверять взаимодействия с этой областью и для определения сродства этого фрагмента к Qk1, мы получили РНК QRE путем транскрипции in vitro и провели серию количественных экспериментов по связыванию.

Во-первых, способность РНК QRE конкурировать с комплексом Qk1-STAR / QSBE была определена с помощью флуоресценции-поляризации (фиг. 4B; Таблица 1), а относительная IC 50 QSBE / QRE равна 0.85. Тот факт, что QRE эффективно конкурирует за привязку Qk1, полностью согласуется с предыдущий отчет, но это также несколько удивительно, так как сайты связывания консенсуса не видны в этой области. Эффективный конкуренцию последовательности QRE, у которой отсутствует консенсус-связывающий сайт, можно рационализировать по крайней мере с помощью двух моделей. Во-первых, Последовательность QRE может содержать единственный сайт с высоким сродством, который не коррелирует с консенсусом гексануклеотидов.Во-вторых, потому что РНК QRE в четыре раза длиннее, чем РНК QSBE, несколько слабых участков частичного связывания Qk1 могут взаимодействовать друг с другом для получения эффективных конкуренция.

Чтобы различать эти модели, взаимодействие между Qk1 и QRE РНК, меченной 5′-концом, контролировали по подвижности геля. сдвиг. Если присутствует один сайт с высоким сродством, то должен быть очевиден один сдвинутый вид, аналогично тому, что наблюдается. для QSBE (рис.3D). Если есть несколько слабых сайтов связывания, то можно будет наблюдать несколько смещенных видов, каждый с более слабой кажущейся константой равновесной диссоциации. Мы наблюдаем последнее (рис. 4Б). По крайней мере, три человека сдвиги присутствуют. Кроме того, кажущаяся константа равновесной диссоциации для этого взаимодействия в 10 раз слабее, чем связывание с QSBE (110 ± 5 нМ, n = 1,8 ± 0,2). В 10 раз более слабое кажущееся связывание при прямом титровании согласуется с модель множественных слабых сайтов и более высокий коэффициент Хилла предполагает, что взаимодействие Qk1 с этой более крупной РНК является кооперативным.Вместе эти данные показывают, что связывание Qk1 с QRE управляется совместным распознаванием нескольких сайтов, а не один согласованный элемент с высоким сродством, как это наблюдается для РНК QSBE. Однако эти эксперименты не затрагивают функциональные возможности. релевантность связывания Qk1 либо с QSBE, либо с QRE РНК.

ОБСУЖДЕНИЕ

Qk1 и GLD-1 распознают сходные детерминанты специфичности последовательности

белки домена STAR / GSG участвуют в регуляции процессов развития у высших эукариот.Члены этой семьи вовлечены в регуляцию трансляции мРНК, стабильности мРНК и альтернативного сплайсинга пре-мРНК (Baehrecke 1997; Jan et al. 1999; Wu et al. 2002; Coyle et al. 2003; Di Fruscio et al. 2003). Белок GLD-1 STAR / GSG является главным регулятором развития зародышевой линии C. elegans ; он подавляет трансляцию нескольких ключевых детерминант во время пространственного и временного развития гонады гермафродита (Francis et al. 1995; Ян и др. 1999; Ли и Шедл 2001; Марин и Эванс 2003). Точно так же белок Mus musculus STAR / GSG (Qk1) участвует в регуляции развития на посттранскрипционном уровне (Ebersole et al. 1996; Larocque et al. 2002; Wu et al. 2002; Lu et al. 2003 г.). Qk1 необходим для правильного образования миелина в ЦНС. Он регулирует схему сращивания нескольких структурных компоненты миелина и необходимы для правильной субклеточной локализации мРНК MBP в олигодендроцитах.

В предыдущих усилиях была определена минимальная последовательность РНК и детерминанта нуклеотидной специфичности для GLD-1 (Ryder et al. 2004). Этот белок распознает гексануклеотидный консенсус 5′-UACU (C / A) A-3 ‘с высоким сродством, а с более низким сродством, расслабленный консенсус 5 ′ — (U> G> C / A) A (C> A) U (C / A> U) A-3 ′. Чтобы определить, обладают ли белки домена STAR / GSG консервативной специфичностью последовательности, была измерена способность Qk1 перекрестно реагировать с мишенью GLD-1 (TGE РНК).Qk1 связывается с этой РНК в три раза слабее чем GLD-1, демонстрируя, что Qk1 способен связываться с аналогичной последовательностью РНК. Однако этот анализ не определяет консенсусная последовательность, необходимая для связывания Qk1.

Чтобы ответить на этот вопрос, способность Qk1 связываться с библиотекой мутантных последовательностей TGE определяли с помощью конкурентной поляризации флуоресценции. С помощью этого анализа определяли консенсусный элемент, необходимый для связывания Qk1.Qk1 распознает 5′-NA (A> C) U (A >> C / U) A-3 ′ консенсус, который очень хорошо коррелирует с расслабленным консенсусом, необходимым для связывания GLD-1. Следовательно, специфика эти два белка домена STAR / GSG являются консервативными.

Хотя Qk1 может распознавать все одинаковые нуклеотиды, присутствующие в расслабленном консенсусе GLD-1, есть несколько заметных различий. в последовательностях, которые содержат сайты наивысшего сродства.Во-первых, Qk1 не отдает предпочтение уридину в первой позиции. Каждая мутация в этом положении связывает также РНК дикого типа. Во-вторых, Qk1 лучше связывается с последовательностями с аденозином в третье положение, тогда как GLD-1 лучше связывается с цитидином. Наконец, Qk1 очень сильно отдает предпочтение аденозину при пятое положение, тогда как GLD-1 одинаково хорошо связывается с аденозином или цитидином.

Ранее модели гомологии GLD-1 и Qk1 были приготовлены на основе структуры ЯМР родственного белка KH / Qua2 SF-1. (Лю и др.2001; Райдер и др. 2004 г.). В этих моделях аминокислоты, контактирующие с РНК, в GLD-1 и Qk1 консервативны на 100%. Это согласуется с сохранением специфичности связывания между этими белками, но не объясняет различия между сайтами связывания с наивысшей аффинностью. Вероятно, что дополнительные остатки, не идентифицированные в моделях, вносят вклад в специфичность связывания. В отсутствие структуры высокого разрешения для любого из этих белков в комплексе с РНК, трудно идентифицировать дополнительные амино кислоты, которые определяют консенсус связывания.Идентификация этих остатков потребует дальнейших экспериментов, которые характеризуют специфичность связывания мутантов GLD-1 и Qk1.

Идентификация сайтов связывания Qk1 в мРНК MBP

MBP является первичным структурным компонентом миелиновой оболочки (Mikoshiba et al. 1991). Этот белок очень положительно заряжен и участвует в уплотнении мембранных слоев при выработке миелина. В качестве таких, экспрессия этого белка локализована в миелиновом компартменте.Экспрессия этого белка вне компартмента цитотоксичен и приводит к преждевременной гибели клеток.

Соответственно, несколько путей посттранскрипционной регуляции контролируют локализованную экспрессию этого генного продукта (рис. 5; де Ферра и др. 1985; Ainger et al. 1993). Сначала мРНК MBP сплайсируется в одну из нескольких изоформ, а затем транспортируется из ядра. Попадая в цитоплазму, это РНК упакована в гранулы с рибосомами 80S и трансляционно замалчивается.Затем гранулы перемещаются из перикариона. через процессы в миелиновый отсек. Наконец, мРНК локализована в отсеке, в котором происходит трансляция MBP. начинается.

С помощью анализа микроинъекций РНК первичных олигодендроцитов крысы были выявлены два функционально разделимых регуляторных элемента. определяется в 3′-UTR мРНК MBP (Ainger et al. 1997). Одна область, называемая RTS для транспортного сигнала РНК, необходима для движения гранул вдоль отростков (рис.3А). Последующие усилия определили высокое сродство Сайт связывания hnRNP A2 в этой области, который необходим для транспортной активности (Kwon et al. 1999). Вторая область, называемая RLR для области локализации РНК, необходима для того, чтобы мРНК MBP проникла в миелиновый компартмент. К сожалению, белковые кофакторы, распознающие это региона не определены.

Несколько линий доказательств предполагают, что Qk1 играет роль в посттранскрипционной регуляции мРНК MBP.Во-первых, мРНК MBP. колокализуется с Qk1 в олигодендроцитах мыши и крысы и при котрансфекции в клетки COS (Larocque et al. 2002). Во-вторых, избыточная экспрессия ядерно-специфической изоформы Qk1 (Qk1-5) приводит к аберрантному накоплению мРНК MBP в ядро (Ли и др., 2000; Ли и др., 2003; Ларок и др., 2002). В-третьих, у мышей qk v / qk v количество мРНК MBP снижено. Наконец, рекомбинантный Qk1, как было показано, взаимодействует с 3′-UTR мРНК MBP in vitro несколькими способами (Li et al. 2000; Larocque et al. 2002).

Чтобы определить сайты связывания для Qk1 в 3′-UTR этого транскрипта, мы искали наличие консенсусного связывания Qk1. сайтов в этой РНК. В этой последовательности присутствуют пять консенсусных сайтов, все из которых расположены ниже RTS. Интересно, два сайта присутствуют в RLR (сайты 906–918 и 923–935).Три дополнительных участка расположены ниже по течению (1060–1072, г. 1273–1285, 1457–1469). Первые три сайта обнаруживаются внутри фрагмента 3′-UTR, показанного Larocque и соавторами (2002), чтобы взаимодействовать с Qk1 в анализе связывания гранул (1-3). Ни один из согласованных сайтов не присутствует во втором идентифицированном элементе этими исследователями около 5′-конца UTR, ранее называвшегося QRE.

Способность Qk1 взаимодействовать с консенсусными сайтами определяли с помощью конкурентного флуоресцентно-поляризационного анализа.Последовательный при консенсусной идентичности все сайты связываются так же или лучше, чем сайт из TGE РНК. Сайт (906–918), который присутствует в элементе локализации, связывается с Qk1 с наивысшим сродством. Три из пяти участков (906–918, 1273–1285, 1457–1469) консервативны между 3′-UTR мыши и крысы. Следовательно, эти сайты являются лучшими кандидатами на функционал Qk1. сайты взаимодействия внутри этой РНК.

Поскольку сайт (906–918) расположен внутри ранее определенного функционального элемента, наиболее эффективно конкурирует и сохраняется между генами мыши и крысы, мы решили дополнительно охарактеризовать это положение. Более длинный вариант РНК (называемый QSBE), содержащий этот сайт был подготовлен, который эквивалентен по длине TGE и позиционирует консенсус в эквивалентном положении относительно к концам 5 ‘и 3’. Способность этой РНК связываться с рекомбинантным Qk1-STAR определяли по поляризации флуоресценции. и анализ сдвига подвижности геля. Qk1-STAR связывается с этой РНК с константой равновесной диссоциации 10 нМ, что эквивалентно к K d GLD-1-STAR для TGE РНК. Кроме того, наблюдается только один сдвинутый вид, что соответствует единственному высокоаффинному связыванию. сайт. Напротив, для взаимодействия между Qk1-STAR и QRE РНК наблюдаются несколько сдвинутых видов.Это говорит о том, что Связывание с этой последовательностью опосредуется несколькими сайтами слабого связывания, а не одним сайтом с высоким сродством.

По крайней мере, два фактора влияют на способность конкретной последовательности РНК образовывать функциональный связывающий элемент Qk1. Во-первых, Относительное сродство Qk1 к отдельной последовательности определяется его консенсусом по связыванию нуклеотидов. Во-вторых, близость Qk1 для конкретной последовательности может модулироваться путем кооперативного взаимодействия с другими факторами, которые связываются с соседней последовательностью. элементов или по его олигомерному состоянию.Здесь мы показываем, что Qk1 с высокой аффинностью связывается с одним сайтом в пределах локализации. элемент UTR, и с более слабым сродством к четырем дополнительным консенсусным сайтам дальше вниз по течению. Кроме того, последовательный с предыдущей работой мы наблюдали совместное связывание Qk1 с несколькими более слабыми сайтами в последовательности QRE (Larocque et al. 2002). Остается увидеть, какие из этих сайтов функционируют индивидуально, опосредуя посттранскрипционную регуляцию, если таковые имеются. стенограммы.Также возможно, что эти сайты функционально избыточны или что привязка Qk1 к каждому сайту может играть особая роль в регуляции мРНК MBP, включая регулирование сплайсинга, ядерного экспорта и локализации в миелине отсек.

Роль Qk1 в регуляции миелинизации

Присутствие сайта связывания Qk1 в RLR сразу предполагает функциональную роль Qk1 в ограничении мРНК MBP до миелиновый отсек.Эта гипотеза согласуется с тремя предыдущими наблюдениями. Во-первых, количество присутствующей мРНК MBP. в очищенном миелине мышей qk v / qk v значительно снижается (Li et al. 2000). Во-вторых, мРНК MBP аномально локализована в культивируемых олигодендроцитах qk v (Barbarese 1991). В-третьих, мРНК MBP преимущественно обнаруживается в ядре олигодендроцитов, выделенных из мозга мышей qk v / qk v (Larocque et al.2002). Вместе с идентификацией сайта связывания с высокой аффинностью эти результаты предполагают, что Qk1 является кофактором, который опосредует локализация через RLR. Однако, поскольку связывание однозначно не коррелирует с биологической функцией, больше экспериментов будет необходимо для подтверждения этой гипотезы.

Было показано, что помимо регуляции мРНК MBP, ядерный Qk1 влияет на паттерн сплайсинга нескольких мРНК, которые код для нескольких структурных компонентов миелина, включая MAG, PLP и MBP (Wu et al.2002). Как упоминалось выше, Qk1 относится к фактору сплайсинга SF-1, необходимому для выбора места ответвления (Berglund et al. 1997). SF-1 распознает РНК, содержащую 5′-YNCURAY-3 ‘консенсус, и кооперативно связывается с U2AF 65/35 в комплексе обязательств сплайсинга (Berglund et al. 1998; Peled-Zehavi et al. 2001). Поскольку элемент связывания STAR / GSG частично перекрывается с консенсусом сайтов ветвления, мы ранее постулировали, что эти белки могут влиять на сплайсинг, конкурируя с SF-1 за РНК сайта разветвления (Ryder et al. 2004 г.). Если это верно для Qk1, то консенсусные сайты связывания Qk1 должны присутствовать в интронах, фланкирующих альтернативно сплайсированные экзоны.

В соответствии с ролью Qk1 в регуляции этих процессов, по крайней мере, один консенсусный сайт связывания Qk1 расположен в интронная последовательность, прилегающая к каждому из регулируемых экзонов. Однако форма альтернативного сращивания, которая возникает для каждого ген довольно разнообразен, что позволяет предположить, что роль Qk1 в регуляции этих процессов может быть переменной (Wu et al.2002). В гене PLP изменен выбор сайта 5′-сплайсинга в экзоне 3. Для MAG усилено включение экзона 12. Для MBP усилено включение экзона 2 и исключение экзонов 5 и 6. Поскольку дефект сращивания для каждого из эти гены широко вариабельны, механизм Qk1 в регуляции альтернативного сплайсинга остается неясным.

Таким образом, эта работа определяет специфичность связывания нуклеотидов STAR / GSG белка Qk1.Распознаваемая консенсусная последовательность Этот белок очень похож на белок C. elegans STAR / GSG GLD-1, показывая, что специфичность связывания сохраняется для подмножества этого семейства РНК-связывающих белков. Однако есть несколько различий между сайтами наивысшего сродства, что указывает на то, что аминокислоты не консервативны между Qk1 и GLD-1 могут модулировать специфичность. На основании этого результата были идентифицированы и охарактеризованы несколько сайтов связывания Qk1. в пределах одной из его родственных мишеней, мРНК MPB.Сайт с наивысшим сродством присутствует в ранее охарактеризованном функциональном область, необходимая для локализации мРНК MBP в миелиновом компартменте. Этот результат согласуется с ролью Qk1 в ограничении Экспрессия MBP в развивающемся миелиновом компартменте.

МАТЕРИАЛЫ И МЕТОДЫ

Конструкции для экспрессии белков и очистка

STAR / GSG-домен Qk1 амплифицировали с помощью ПЦР из pRO-EXHT-Qk1-STAR с использованием следующих праймеров: 5′-CGG GAT CCA TGG TCG GGG AAA TGG AA-3 ‘и 5′-CCC AAG CTT TCA TTA TCT GTA GGT GCC ATT CAG-3’.Полученный продукт переваривали Bamh2 и HindIII и субклонировали в pMal-c (NEB) для получения pMal-Qk1-STAR.

Qk1-STAR экспрессировалось из этой плазмиды в штамме Escherichia coli JM109 путем индукции культур в средней логарифмической фазе в течение трех часов с 1 мМ IPTG при 37 ° C. Белок очищен из 1 л. культуры в виде слияния с мальтозосвязывающим белком в три этапа. Первоначальная очистка была достигнута от растворимого клеточного лизата. с помощью аффинной хроматографии с использованием амилозной смолы (NEB) в буфере для лизиса (50 мМ Tris-Cl при pH 8.0, 200 мМ NaCl и 2 мМ ДТТ). Белок элюировали из колонки в буфере для лизиса с добавлением 10 мМ мальтозы (Sigma). Фракции, содержащие Qk1-STAR были объединены, разбавлены в пять раз в буфере HS (50 мМ MOPS при pH 6,0, 2 мМ DTT) и дополнительно очищены катионом POROS-HS. обменять колонку в градиенте от 0 до 2 M NaCl с помощью SPRINT Bio-CAD (PerSeptive Biosystems). Фракции, содержащие Белок объединяли, разбавляли буфером HQ (75 мМ Трис при pH 8.8,2 мМ DTT) и очищали до гомогенности с помощью POROS-HQ. анионообменная колонка с градиентом от 0 до 2 М NaCl. Чистые фракции объединяли, диализовали в буфер для хранения (20 мМ Трис при pH 8,0, 25 мМ NaCl, 2 мМ DTT) и хранили при 4 ° C. Концентрация очищенного белка определялась в 6 М гуанидин-HCl с помощью УФ-спектроскопии при 280 нм с использованием рассчитанного молярного коэффициента экстинкции 76810 M -1 . Типичные выходы для этого препарата составляют ~ 15 мг / л культуры, а чистота> 95%, по оценке SDS-полиакриламида, окрашенного куммасси. гель и масс-спектрометрией MALDI-TOF (матричная лазерная десорбционная ионизация по времени пролета).GLD-1-STAR очищен как описано ранее (Ryder et al. 2004).

Препарат РНК-конструкции

Все олигонуклеотиды РНК, за исключением РНК QRE, были приобретены у Dharmacon. Олигонуклеотиды РНК были снимают защиту, очищают, лиофилизируют и хранят в соответствии с протоколом производителя. Конструкции РНК, используемые для изменения подвижности геля эксперименты были помечены радиоактивным изотопом на 5′-конце и очищены с использованием γ- 32 P-ATP (Perkin Elmer) и полинуклеотидкиназы Т4 (NEB), как описано ранее (Ryder et al.2004 г.). РНК, меченные 5′-флуоресцеином, были приобретены у Dharmacon и обработаны в темноте.

РНК

QRE получали транскрипцией in vitro из pUC-18-QRE. Эта плазмида была создана из следующих шести олигонуклеотидов ДНК: QRE-1, GCGCGAATTCTAATACGACTCAC TATAGGCCTTAAACTTTTAAT; QRE-2, CTAGCTAATCGGTG CAAGTAGAATTAAAAGTTTAAGGCCTATAG; QRE-3, TCTAC TTGCACCGATTAGCTAGTTAGAGCAGACCCTCTCTTAAT; QRE-4, ACCGCGATCACGGCTCCACGGGATTAAGAGAGGGTCT GCTCTAA; QRE-5, CCCGTGGAGCCGTGATCGCGGTGGGG CCAGGCCCACGGCACCCC; и QRE-6, GCGCGGATCCCTCTT CGCAGTCGGGGTGCCGTGGGCCTGGCCCC.Каждый олигонуклеотид индивидуально фосфорилировали с использованием полинуклеотидкиназы Т4, затем смешивают в реакции отжига и обрабатывают ДНК-лигазой Т4. Полученный дуплексный продукт использовали в качестве шаблона для ПЦР. с QRE-1 и QRE-2. Продукт расщепляли EcoR1 и HindIII и клонировали в pUC-18. Транскрипционные реакции были выполняли в буфере для транскрипции (40 мМ Трис при pH 8,0, 5 мМ DTT, 2 мМ спермидин, 12,5 мМ MgCl 2 , 1 Мм каждого NTP) с использованием 40 нг / мл линеаризованной плазмидной матрицы Ear1 и 0. 1 мг / мл РНК-полимеразы Т7 в течение 3 часов. Продукт РНК очищали на денатурирующем геле (8% полиакриламид 39: 1, 7 М мочевина, 1 × TBE), визуализировали УФ-затенением, элюировали в TEN с помощью методом измельчения / замачивания осаждали этанолом, ресуспендировали в ТЕ и хранили при -20 ° C. Концентрация QRE РНК составляла измерено УФ-спектроскопией при 260 нм с использованием рассчитанного коэффициента экстинкции 1183,7 мМ -1 .

Анализ сдвига электрофоретической подвижности

Комплекс между рекомбинантными белками домена STAR / GSG и TGE, QSBE или QRE РНК визуализировали с помощью электрофоретической подвижности геля. сдвиг пробирный.Постоянная концентрация радиоактивно меченой РНК (100 пМ) уравновешивалась различными концентрациями слитого белка. в буфере для уравновешивания (10 мМ Трис при pH 8,0, 25 мМ NaCl, 0,1 мМ ЭДТА, 0,1 мг / мл тРНК, 5 мкг / мл гепарина и 0,01% IGEPAL CA630). Меченую радиоактивным изотопом РНК нагревали до 90 ° C в течение 2 минут, а затем давали возможность медленно остыть в течение 30 минут до комнатной температуры. для уравновешивания с белком. Обычно 20 мкл реакционной смеси инкубировали при комнатной температуре не менее 3 часов.Прежний перед загрузкой к каждому образцу добавляли 4 мкл загрузочного красителя типа III (30% об. / об. глицерина, 0,05% мас. / об. ксилолцианола). Порция 5 мкл каждой реакции загружали на предварительный прогон нативного полиакриламидного геля (6% 29: 1 акриламид / бис-акриламид, 0,5 × TBE) с напряжение установлено на 100 В. Гели запускали при 600 В в течение 30 минут, прежде чем они были высушены и экспонированы на экране PhosphorImager в течение ночи. (Молекулярная динамика). Долю связанной РНК определяли с помощью программного обеспечения ImageQuant (Molecular Dynamics).

Анализ поляризации флуоресценции

Был описан количественный анализ взаимодействий белок / нуклеиновая кислота с помощью флуоресценции-поляризации (LeTilly and Royer 1993). Экспериментальная установка для анализа флуоресцентно-поляризационного титрования была идентична электрофоретической подвижности. сдвиг, за исключением того, что 1 нМ меченой флуоресцеином РНК TGE или QSBE использовали вместо радиоактивно меченной РНК, и реакции были выполняется в общем объеме 100 мкл.Образцы уравновешивали в 96-луночных непрозрачных микротитровальных планшетах fluotrak 200 (Grenier). и поляризация определялась с использованием планшет-ридера Fusion α-FP (Packard). Среднее и стандартное отклонение значения mP для каждого белка концентрацию рассчитывали по 10 последовательным показаниям на каждом планшете.

Конкурсные эксперименты по флуоресценции-поляризации проводили в идентичных условиях, за исключением того, что постоянная концентрация Qk1-STAR был включен в каждое уравновешивание.Концентрация белка была выбрана из расчета 70–90% связанного комплекса. В экспериментах по конкуренции с TGE использовали постоянную концентрацию Qk1-STAR 200 нМ. В соревновательных экспериментах QSBE Использовали 80 нМ белка. Немеченую РНК конкурента титровали в каждой реакции при различных концентрациях и позволяли уравновесить в течение 3 ч перед считыванием планшета.

Анализ данных

Кажущаяся константа равновесной диссоциации для прямого титрования сдвига электрофоретической подвижности и флуоресценции-поляризации анализы были определены на основе соответствия данных с использованием нелинейной регрессии наименьших квадратов с использованием IGOR (Wavemetrics). Очевидное Константу равновесной диссоциации Qk1 и GLD-1 для каждого варианта РНК определяли с использованием уравнения:

, где f — связанная фракция или значение mP, [P] — концентрация слитого белка, K d — константа равновесной диссоциации, n — коэффициент Хилла, m — максимальный сигнал, а b — базовый сигнал. В кажущийся K d эквивалентен

Сообщенное значение Kd для каждого варианта является средним значением по крайней мере трех независимых экспериментов.

IC 50 для каждого участника был определен путем взвешивания по следующему уравнению:

, где C — концентрация немеченого конкурента, а IC 50 — концентрация конкурентной РНК, которая замещает 50% меченой РНК. Константа равновесной диссоциации для каждого конкурента (K C ) был рассчитан путем подгонки данных к квадратичному решению уравнения Лина и Риггса (Лин и Риггс, 1972; Уикс и Кротерс, 1992):

, где mP max — поляризация при насыщении, mP base — поляризация в отсутствие белка, а R — концентрация РНК, меченной флуоресцеином.Это решение предполагает что стехиометрия меченой РНК и конкурента идентична и, следовательно, не может применяться во всех ситуациях. Следовательно, сравнительные анализы ингибирования проводили непосредственно на основании значений IC 50 для экспериментов, проводимых в тот же день. Каждый эксперимент проводился как минимум в двух экземплярах. Сообщенные ошибки для аппроксимации Линя и Риггса представляют собой 95% доверительные интервалы для подобранных параметров, которые обычно были больше стандартных отклонения.

ТАБЛИЦА 1.

Анализ связывания Qk1-STAR с РНК

ТАБЛИЦА 2.

Конкурсы консенсусных площадок

РИСУНОК 1.

Qk1-STAR связывается с РНК TGE. ( A ) Доменная структура продукта гена мышиного Quaking . Домен STAR / GSG состоит из доменов Qua1, KH и Qua2. Две богатые пролином области опосредуют взаимодействие с доменами Sh4. Несколько изоформ, подвергнутых альтернативному сплайсингу, дают белки с вариантами С-концов (обозначены пунктирным узором). Показана последовательность РНК TGE. Гексануклеотидный консенсус-связывающий элемент выделен серым цветом.( B ) След типичного флуоресцентно-поляризационного титрования Qk1-STAR в меченную флуоресцеином РНК TGE. Планки погрешностей представляют стандартное отклонение 10 считываний с одной и той же пластины. Константа равновесной диссоциации, коэффициент Хилла и 95% Показаны доверительные интервалы этих параметров для данного эксперимента. ( C ) Титрование смещения электрофоретической подвижности Qk1-STAR на радиоактивно меченую РНК TGE. Аннотированы виды связанной и свободной РНК.Подгонка доли связанной РНК в зависимости от концентрации Qk1-STAR, константы равновесной диссоциации, коэффициента Хилла, и 95% доверительные интервалы для этого конкретного эксперимента показаны ниже.

РИСУНОК 2.

Определение специфичности связывания Qk1.( A ) График нормализованной поляризации как функции концентрации конкурирующей РНК для самоконкуренции TGE и для нескольких репрезентативные мутантные 12-мерные РНК. Планки погрешностей представляют собой стандартное отклонение 10 считываний с одного планшета. ( B ) Таблица относительного значения IC 50 для каждого мутантного 12-мера по сравнению с 12-мерной последовательностью дикого типа. Относительный IC 50 указан как <0,3, если кажущийся IC50 составляет> 15 мкМ.

РИСУНОК 3.

Идентификация сайтов связывания Qk1 в 3′-UTR мРНК MBP. ( A ) Структура 3′-UTR мРНК MBP. Схема нумерации начинается с 5′-конца 3′-UTR. Консенсусные сайты связывания Qk1 помечены белыми рамками.Ранее идентифицированные элементы в UTR помечены серыми полями. ( B ) График нормализованной поляризации в зависимости от концентрации конкурентной РНК для каждого из пяти консенсусных сайтов и для полусайта TGE. ( C ) Нуклеотидная последовательность и положение сайтов связывания Qk1 в 3′-UTR мРНК MBP. ( D ) Типичный сдвиг электрофоретической подвижности связывания Qk1-STAR с QSBE РНК. Отмечены виды связанной и свободной РНК. Сюжет фракция связанной QSBE РНК vs.Показана концентрация Qk1-STAR. Константа равновесной диссоциации, коэффициент Хилла и Даны 95% доверительные интервалы для этого эксперимента. ( E ) Типичное флуоресцентно-поляризационное титрование Qk1-STAR в меченную флуоресцеином QSBE РНК. Планки погрешностей выводятся как на рисунке 1B.

РИСУНОК 4.

Анализ связывания Qk1 с QRE РНК. ( A ) График конкурентных экспериментов по поляризации флуоресценции для QSBE, QRE и контрольной поли-U РНК. ( B ) Сдвиг электрофоретической подвижности связывания Qk1-STAR с QRE РНК. Отмечены виды связанной и свободной РНК. Доля связанного РНК определяли путем группирования всех сдвинутых видов и наносили на график зависимости от концентрации Qk1-STAR. Равновесие Показаны константа диссоциации, коэффициент Хилла и 95% доверительные интервалы от этого соответствия.

РИСУНОК 5.

Этапы посттранскрипционной регуляции мРНК MBP в глиальных клетках олигодендроцитов. Стенограммы объединены в один нескольких изоформ (I), экспортируемых из ядра в перикариальное пространство, где он упаковывается в гранулы (II), транспортируется вдоль отростков (III), а затем локализуется в миелиновом компартменте (IV).

Благодарности

Мы благодарим доктора Эндрю Кармела и доктора Катрину Леманн-Блаунт за полезные обсуждения и критические комментарии относительно этой рукописи, и доктору Трейси Танака-Холл за щедрое предоставление клона домена Qk1 STAR / GSG. С.П.Р. поддерживается Дэймоном Руньоном Стипендия Фонда исследований рака (DRG-1723).Это исследование было поддержано грантом Национального института здоровья. (NIH, GM53320) на имя J.R.W.

Расходы на публикацию этой статьи были частично покрыты за счет оплаты страницы. Поэтому эта статья должна быть настоящим помечены как «реклама» в соответствии с разделом 1734 Кодекса США 18 исключительно для того, чтобы указать на этот факт.

ССЫЛКИ

  1. Эйнгер, К., Avossa, D., Morgan, F., Hill, S.J., Barry, C., Barbarese, E., and Carson, J.H. 1993. Транспорт и локализация мРНК экзогенного основного белка миелина, микроинъектированная в олигодендроциты. J. Cell Biol. 123 : 431–441.

  2. Эйджер, К., Авосса, Д., Диана, А., С., Барри, К., Барбарез, Э. и Карсон, Дж. Х. 1997. Транспорт и элементы локализации в мРНК основного белка миелина.J. Cell. Биол. 138 : 1077–1087.

  3. Эшли-младший, К.Т., Уилкинсон, К.Д., Рейнс, Д., и Уоррен, С.Т. 1993. Белок FMR1: консервативные домены семейства РНП и избирательное связывание РНК. Наука 262 : 563–566.

  4. Baehrecke, E.H. 1997., который кодирует белок, связывающий РНК KH, который участвует в развитии мышц. Разработка 124 : 1323–1332.

  5. Barbarese, E. 1991. Пространственное распределение мРНК и полипептида основного белка миелина в дрожащих олигодендроцитах в культуре. J. Neurosci. Res. 29 : 271–281.

  6. Берглунд, Дж. A., Chua, K., Abovich, N., Reed, R., and Rosbash, M. 1997. Фактор сплайсинга BBP специфически взаимодействует с пре-мРНК последовательностью точки ветвления UACUAAC. Ячейка 89 : 781–787.

  7. Берглунд, Дж. А., Абович, Н. и Росбаш, М. 1998. Кооперативное взаимодействие между U2AF65 и mBBP / SF1 способствует распознаванию области точки ветвления.Genes Dev. 12 : 858–867.

  8. Чен Т. и Ричард С. 1998. Структурно-функциональный анализ Qk1: ​​летальная точечная мутация при сотрясении мышей предотвращает гомодимеризацию. Мол. Клетка. Биол. 18 : 4863–4871.

  9. Койл, Дж.H., Guzik, B.W., Bor, Y.C., Jin, L., Eisner-Smerage, L., Taylor, S.J., Rekosh, D., and Hammarskjold, M.L. 2003. Sam68 усиливает использование в цитоплазме интрон-содержащей РНК и функционально регулируется ядерной киназой. Sik / BRK. Мол. Cell Biol. 23 : 92–103.

  10. de Ferra, F., Engh, H., Hudson, L., Kamholz, J., Puckett, C., Molineaux, S., and Lazzarini, R.A. 1985. Альтернативный сплайсинг объясняет четыре формы основного белка миелина. Ячейка 43 : 721–727.

  11. Di Fruscio, M., Styhler, S., Wikholm, E., Boulanger, MC, Lasko, P. , and Richard, S. 2003. Kep1 генетически взаимодействует с dredd / каспазой-8, а мутанты kep1 изменяют баланс изоформ дредд.Proc. Natl. Акад. Sci. 100 : 1814–1819.

  12. Ebersole, T.A., Chen, Q., Justice, M.J., and Artzt, K. 1996. Продукт гена дрожания, необходимый в эмбриогенезе и миелинизации, сочетает в себе особенности связывания РНК и передачи сигнала. белки. Nat. Genet. 12 : 260–265.

  13. Фрэнсис, Р., Barton, M.K., Kimble, J., and Schedl, T. 1995. gld-1, ген-супрессор опухоли, необходимый для развития ооцитов у Caenorhabditis elegans . Генетика 139 : 579–606.

  14. Харди, Р.Дж. 1998a. Молекулярные дефекты в дисмиелинизирующем мутантном землетрясении. J. Neurosci. Res. 51 : 417–422.

  15. ———.1998b. Экспрессия QKI регулируется во время принятия решений о судьбе нейрон-глиальных клеток. J. Neurosci. Res. 54 : 46–57.

  16. Hardy, RJ, Loushin, CL, Friedrich Jr., VL, Chen, Q., Ebersole, TA, Lazzarini, RA, and Artzt, K. 1996. Специфическая для нервных клеток экспрессия белков QKI изменена у дрожащих мутантов. мышей. J. Neurosci.16 : 7941–7949.

  17. Ян, Э. , Моцны, К. К., Грейвс, Л. Е., и Гудвин, Э. Б. 1999. Белок STAR, GLD-1, является трансляционным регулятором половой идентичности у Caenorhabditis elegans . EMBO J. 18 : 258–269.

  18. Правосудие, М.Дж. И Боде, В. 1988. Три вызванные ENU аллели локуса мышиного дрожания являются рецессивными эмбриональными летальными мутациями. Genet. Res. 51 : 95–102.

  19. Kwon, S., Barbarese, E., and Carson, J.H. 1999. Сигнал переноса цис--действующей РНК от мРНК основного белка миелина и его родственный -транс--действующий лиганд hnRNP A2 усиливают кэп-зависимую трансляцию.J. Cell Biol. 147 : 247–256.

  20. Ларок, Д., Пилот, Дж., Чен, Т., Клотье, Ф., Масси, Б., Педраса, Л., Кутюр, Р., Ласко, П., Алмазан, Г., и Ричард, S. 2002. Ядерное удержание мРНК MBP у дрожащих жизнеспособных мышей. Нейрон 36 : 815–829.

  21. Ли, М.Х. и Шедл Т. 2001. Идентификация in vivo мРНК-мишеней GLD-1, мотива maxi-KH, содержащего белок, необходимый для развития зародышевых клеток C. elegans . Genes Dev. 15 : 2408–2420.

  22. ЛеТилли В. и Ройер К.А. 1993. Анализ анизотропии флуоресценции предполагает участие белок-белковых взаимодействий в регуляции связывания ДНК репрессора trp. Биохимия 32 : 7753–7758.

  23. Li, Z., Zhang, Y., Li, D., and Feng, Y. 2000. Дестабилизация и неправильная локализация мРНК основного белка миелина при дрожащей дисмиелинизации без связывания РНК QKI белки. J. Neurosci. 20 : 4944–4953.

  24. Линь, С.Y. и Riggs, A.D. 1972. Связывание репрессора Lac с неоператорной ДНК: подробные исследования и сравнение методов равновесия и скорости конкуренции. J. Mol. Биол. 72 : 671–690.

  25. Лю, З., Лютен, И., Боттомли, М.Дж., Мессиас, А.К., Хунгнину-Моланго, С., Шпрангерс, Р., Заньер, К., Крамер, А., и Саттлер, М. 2001. Структурные основы распознавания РНК сайта разветвления интрона фактором сплайсинга 1. Science 294 : 1098–1102.

  26. Лу, З., Чжан, Ю., Ку, Л., Ван, Х., Ахмадиан, А., и Фэн, Ю., 2003. Сотрясающая жизнеспособная мутация влияет на экспрессию мРНК qkI, в частности, в миелин-продуцирующих клетках нервной системы. система.Nucleic Acids Res. 31 : 4616–4624.

  27. Марин В.А. и Эванс, Т. 2003. Репрессия трансляции мРНК Notch C. elegans белком GLD-1 домена STAR / KH. Разработка 130 : 2623–2632.

  28. Микошиба, К., Окано, Х., Тамура, Т. и Икенака, К. 1991. Структура и функция генов миелинового белка. Анну. Rev. Neurosci. 14 : 201–217.

  29. Пелед-Зехави, Х., Берглунд, Дж. А., Росбаш, М., и Франкель, А. Д., 2001. Распознавание последовательностей точки ветвления РНК доменом KH фактора сплайсинга 1 (связывающий белок точки ветвления млекопитающих) в комплексе факторов сплайсинга.Мол. Клетка. Биол. 21 : 5232–5241.

  30. Perrone-Bizzozero, N. и Bolognani, F. 2002. Роль HuD и других РНК-связывающих белков в нервном развитии и пластичности. J. Neurosci. Res. 68 : 121–126.

  31. Рихтер, Дж.Д. и Лоренц, Л.Дж. 2002. Селективная трансляция мРНК в синапсах. Curr. Opin. Neurobiol. 12 : 300–304.

  32. Ryder, S.P., Frater, L., Abramovitz, D.L., Goodwin, E.B., and Williamson, J.R. 2004. Специфичность РНК-мишени посттранскрипционного регуляторного белка GLD-1 домена STAR / GSG. Nat. Struct. Мол. Биол. 11 : 20–28.

  33. Saccomanno, L. , Loushin, C., Jan, E., Punkay, E., Artzt, K., and Goodwin, E.B. 1999. STAR-белок QKI-6 является репрессором трансляции. Proc. Natl. Акад. Sci. 96 : 12605–12610.

  34. Сидман Р.Л., Дики, М.М., Аппель, С.Х. 1964. Мыши-мутанты (Quaking и Jimpy) с недостаточной миелинизацией центральной нервной системы. Наука 144 : 309–311.

  35. Сабо, А., Далмау, Дж., Мэнли, Г., Розенфельд, М., Вонг, Э., Хенсон, Дж., Познер, Дж. Б., и Фурно, Х.М. 1991. HuD, антиген паранеопластического энцефаломиелита, содержит РНК-связывающие домены и гомологичен Elav и Sex-lethal.Ячейка 67 : 325–333.

  36. Vernet, C. и Artzt, K. 1997. STAR, семейство генов, участвующих в передаче сигнала и активации РНК. Тенденции Genet 13 : 479–484.

  37. Недель, К.М. и Кротерс, Д. 1992. Анализы связывания РНК для пептидов, производных от Tat: значение для специфичности. Биохимия 31 : 10281–10287.

  38. Wu, J., Zhou, L., Tonissen, K., Tee, R., and Artzt, K. 1999. Сотрясающий белок I-5 (QKI-5) имеет новый сигнал ядерной локализации и перемещается между ядро и цитоплазма. Дж.Биол. Chem. 274 : 29202–29210.

  39. Wu, J. I., Reed, R.B., Grabowski, P.J., and Artzt, K. 2002. Функция сотрясения при миелинизации: регулирование альтернативного сплайсинга. Proc. Natl. Акад. Sci. 99 : 4233–4238.

Merrill Lynch Depositor Inc Pplus Trust Series Gsg 1 Годовой отчет за 2009 год 10-K

ЛОР> 10-К 1 e38136_10k.htm ГОДОВОЙ ОТЧЕТ

Комиссия по ценным бумагам и биржам

ВАШИНГТОН, округ Колумбия 20549

ФОРМА 10-К

ГОДОВОЙ ОТЧЕТ

В соответствии с разделом 13 или 15 (d)
Закона о фондовых биржах 1934 года

На закончившийся финансовый год: Номер комиссии:
31 декабря 2009 г. 001-31604

MERRILL LYNCH DEPOSITOR, INC.

(ОТ ИМЕНИ PPLUS TRUST СЕРИИ GSG-1)

(точное наименование регистранта указано в его уставе)

DELAWARE
(Штат или другая юрисдикция
, в которой учреждение
)
13-38


(Идентификационный номер работодателя I. R. S.
)
ONE BRYANT PARK
NEW YORK, NEW YORK
(адрес основных исполнительных офисов
)
10036
(почтовый индекс)

Номер телефона регистранта, включая код города: (212) 449-1000

Ценные бумаги, зарегистрированные в соответствии с разделом 12 (b) Закона:

Доверительных сертификатов PPLUS серии GSG-1, котирующихся на Нью-Йоркской фондовой бирже.

Ценные бумаги, зарегистрированные в соответствии с разделом 12 (g) Закона:

Не применимо.

Отметьте галочкой, если регистрант является хорошо известным опытным эмитентом, как это определено в Правиле 405 Закона о ценных бумагах.

Да или Нет þ

Отметьте галочкой, если регистрант не обязан подавать отчеты в соответствии с Разделом 13 или Разделом 15 (d) Закона.

Да или Нет þ

Отметьте галочкой, подал ли регистрант (1) все отчеты, которые должны быть поданы в соответствии с разделом 13 или 15 (d) Закона о фондовых биржах 1934 года в течение предшествующие 12 месяцев (или за такой более короткий период, что регистрант должен был подавать такие отчеты), и (2) подпадал под действие таких требований в течение последних 90 дней.

Да þ Нет o

Отметьте галочкой, отправил ли регистрант в электронном виде и разместил ли на своем корпоративном веб-сайте, если таковой имеется, каждый интерактивный файл данных, который необходимо отправить и опубликовать в соответствии с Правило 405 Регламента S-T в течение предшествующих 12 месяцев (или на такой более короткий период, что регистрант должен был предоставить и опубликовать такие файлы).

Да ○ Нет ○

Отметьте галочкой, если раскрытие заявителей-нарушителей в соответствии с пунктом 405 Регламента S-K не содержится в данном документе и не будет содержаться, насколько это возможно для регистранта. знание, в окончательных доверенностях или информационных заявлениях, включенных посредством ссылки в Часть III этой формы 10-K или в любую поправку к этой форме 10-K.o

Отметьте галочкой, является ли регистрант крупной системой ускоренной подачи, системой ускоренной подачи, неускорительной системой подачи отчетов или небольшой отчитывающейся компанией. См. Определения слова «большой ускоренная подача »,« ускоренная подача »и« меньшая отчитывающаяся компания »в Правиле 12b-2 Закона о биржах.

Большой ускоренный фильтр o Ускоренный фильтр o Неускорительный фильтр þ Меньший отчетный файл о

Отметьте галочкой, является ли регистрант фиктивной компанией (как определено в Правиле 12b-2 Закона).

Да или Нет þ

Укажите совокупную рыночную стоимость обыкновенных акций с правом голоса и без права голоса, принадлежащих неаффилированным компаниям, рассчитанную со ссылкой на цену, по которой обыкновенные акции были проданы в последний раз, или средняя цена спроса и предложения таких обыкновенных акций по состоянию на последний рабочий день последнего завершившегося второго финансового квартала регистранта.

Не применимо.

Укажите количество акций в обращении для каждого из классов обыкновенных акций регистранта на самую последнюю возможную дату.

Не применимо.

ДОКУМЕНТЫ, ВКЛЮЧЕННЫЕ ПО ИСПОЛЬЗОВАНИЮ

Нет.



СОДЕРЖАНИЕ



ДОКУМЕНТЫ, ВКЛЮЧЕННЫЕ ПО ССЫЛКЕ

Нет.

ЧАСТЬ I

ПУНКТ 1. БИЗНЕС

Для получения информации об основных ценных бумагах, принадлежащих PPLUS Trust Series GSG-1, пожалуйста, обратитесь к Goldman Sachs Group, Inc. (номер файла комиссии 001-14965) периодические отчеты, включая годовые отчеты по форме 10-K, ежеквартальные отчеты по форме 10-Q и текущие отчеты по форме 8-K, а также другую информацию, хранящуюся в Комиссии по ценным бумагам и биржам ( «ТРЦ»).Вы можете прочитать и скопировать эти отчеты и другую информацию в общедоступных справочных центрах, поддерживаемых SEC, в комнате 1580, 100 F Street, N.E., Washington, D.C. 20549. Вы можете получить копии этого материала за определенную плату, написав в отдел публичных справок SEC по адресу: 100 F Street, N.E., Washington, D.C. 20549. Вы можете получить информацию о работе в общественную справочную комнату, позвонив в SEC по телефону 1-800-SEC-0330. Вы также можете получить доступ к некоторой части этой информации в электронном виде на веб-сайте SEC в Интернете по адресу http: // sec.отчет, который содержит отчеты, доверенность и информационные заявления и другую информацию, которую эмитент соответствующих ценных бумаг подал в электронном виде в SEC.

Хотя у нас нет оснований полагать, что информация о базовых ценных бумагах или эмитенте базовых ценных бумаг, содержащаяся в базовых ценных бумагах эмитента Отчеты Закона о биржах не являются достоверными, ни вкладчик, ни доверительный управляющий не участвовали в подготовке таких документов и не проводили каких-либо проверок в отношении информации. предусмотрено в нем.Отсутствие расследования в отношении соответствующего эмитента ценных бумаг (включая, помимо прочего, расследование его финансового состояния или кредитоспособности) или базовые ценные бумаги были сделаны. Вы должны получить и оценить ту же информацию о соответствующем эмитенте ценных бумаг, какую вы бы получили и оценили, если бы ваши инвестиции были непосредственно в базовых ценных бумагах или в других ценных бумагах, выпущенных эмитентом соответствующих ценных бумаг. Не может быть никакой гарантии, что события, влияющие на базовые ценные бумаги или базовые ценные бумаги эмитента не произошло или еще не было публично раскрыто, что могло бы повлиять на точность или полноту общедоступных документов, описанных выше.

2



ПУНКТ 1А. ФАКТОРЫ РИСКА

Ваше вложение в трастовые сертификаты сопряжено с определенными рисками. Вам следует внимательно рассмотреть следующее обсуждение рисков, а также другую включенную информацию или включены посредством ссылки в применимое приложение к проспекту эмиссии и прилагаемый проспект эмиссии. Вам также следует внимательно рассмотреть любые факторы риска и другую информацию, лежащую в основе эмитент ценных бумаг может подавать в своем Акте о биржах отчеты, как указано в пункте 1 выше.

ЕСЛИ БАЗОВЫЕ ЦЕННЫЕ БУМАГИ ВЫКЛЮЧЕНЫ ДО ДАТЫ ДАТЫ ИХ ОБРАЗОВАНИЯ ИЛИ ЕСЛИ КАКИЕ-ЛИБО ГАРАНТИИ ВЫПОЛНЯЮТСЯ ДО ЗАЯВЛЕННОЙ ДАТЫ ЗРЕШЕНИЯ, ВЫ НЕ СМОЖЕТЕ ПЕРЕИНВЕСТИРОВАТЬ ВАШ ВЫКУП ИЛИ ЗВОНОК ПРОИЗВОДИТСЯ С ДОХОДНОСТЬЮ, СРАВНИТЕЛЬНОЙ С ДОХОДНОСТЬЮ, КОТОРОЙ ВЫ БЫЛИ ПОЛУЧИЛИ НА ВАШИХ СЕРТИФИКАТАХ ДОВЕРИЯ

Доходность, которую вы получите от своих сертификатов доверия, зависит от нескольких факторов, в том числе:

закупочная цена трастовых сертификатов,
при получении сертификатов доверия,
, использует ли эмитент базовых ценных бумаг свой опцион на выкуп базовых ценных бумаг, и
, используют ли держатели ордеров на вызов свои факультативные права на покупку неисполненных доверительных сертификатов.

Эмитент базовых ценных бумаг имеет право выкупить базовые ценные бумаги полностью или частично по своему усмотрению или полностью, если он будет обязан уплатить дополнительные суммы. Поскольку эмитент базовых ценных бумаг имеет право досрочно выкупить базовые ценные бумаги, мы не можем гарантировать вам, что траст сможет удерживать базовые ценные бумаги до тех пор, пока они не будут срок погашения.

Хотя держатели ордеров на звонки не обязаны исполнять ордера на звонки, доход, который вы получите от своих сертификатов доверия, зависит от того, является ли ордер на звонок держатели используют свои ордера на вызов для покупки доверительных сертификатов.

Преобладающие процентные ставки на момент досрочного погашения или исполнения отзыва могут быть ниже, чем доходность ваших трастовых сертификатов. Следовательно, вы не сможете понять сопоставимая доходность при реинвестировании средств, которые вы получаете от досрочного погашения или исполнения любых ордеров на колл. Кроме того, если преобладающая рыночная стоимость доверительных сертификатов превышает цена выкупа или цена исполнения call, уплаченная вам при погашении базовых ценных бумаг или исполнении call, вы не сможете реализовать такое превышение.

3



ВАМ МОГУТ НЕ ОПЛАЧИТЬСЯ, ЕСЛИ АКТИВОВ ТРАСТА НЕДОСТАТОЧНО

В настоящее время траст не имеет значительных активов, кроме лежащих в основе ценных бумаг. Если базовых ценных бумаг недостаточно для осуществления платежей или распределений по трасту сертификаты, никаких других активов для оплаты дефицита не будет. Эмитент базовых ценных бумаг организован как холдинговая компания, владеющая дочерними компаниями. Согласно базовый проспект ценных бумаг, эти дочерние компании осуществляют практически всю деятельность эмитента базовых ценных бумаг, что приводит к трем основным рискам:

право эмитента базовых ценных бумаг участвовать в качестве держателя капитала в любом распределении активов любой из его дочерних компаний при ликвидации дочерней компании или иным образом, и, таким образом, способность держателей ценных бумаг, включая траст, получать выгоду от распределения уступает кредиторам дочерней компании, за исключением тех случаев, когда какие-либо претензии к эмитенту лежащих в основе ценных бумаг могут иметь в качестве кредитора дочерней компании признаны,
дивидендов, ссуд и авансов соответствующему эмитенту ценных бумаг от некоторых его дочерних компаний, включая Goldman, Sachs & Co. , ограничены требованиями к чистому капиталу в соответствии с Закон о фондовых биржах 1934 года и в соответствии с правилами бирж ценных бумаг и других регулирующих органов и, следовательно, доступ основного эмитента ценных бумаг к средствам для оплаты своих обязательств, включая базовые ценные бумаги, ограничено, и
, поскольку некоторые из дочерних компаний эмитента базовых ценных бумаг являются товариществами, в которых он является генеральным партнером, эмитент базовых ценных бумаг может нести ответственность по их обязательствам.В Эмитент базовых ценных бумаг также гарантирует многие обязательства своих дочерних компаний. Любая ответственность, которую эмитент базовых ценных бумаг может иметь по обязательствам своих дочерних компаний, может уменьшить активы, которые доступны для удовлетворения его прямых кредиторов, включая инвесторов в его ценные бумаги, включая траст.

ВЫ НЕ МОЖЕТЕ ВОССТАНОВИТЬ ПОЛНОСТЬЮ НАСТОЯЩУЮ СТОИМОСТЬ ИЛИ ЗАЯВЛЕННУЮ СУММУ (ЕСЛИ ПРИМЕНИМО) ВАШИХ СЕРТИФИКАТОВ ДОВЕРИЯ, ЕСЛИ ТРАСТ УДАЛИТ БАЗОВЫЕ ЦЕННЫЕ БУМАГИ ПО УМОЛЧАНИЮ ЭМИТЕНТ БОНУСНЫХ ЦЕННЫХ БУМАГ ИЛИ В СЛУЧАЕ, ЧТО ЭМИТЕНТ БУМАЖНЫХ ЦЕННЫХ БУМАГ ПРЕКРАЩАЕТ ПРЕДСТАВЛЕНИЕ ОТЧЕТОВ

Если эмитент базовых ценных бумаг не выполняет свои обязательства по базовым ценным бумагам или эмитент базовых ценных бумаг прекращает подавать отчеты по Акту о биржах, то траст будет либо распределять лежащие в основе ценные бумаги держателям трастовых сертификатов, либо избавляться от них и распределять доходы держателям трастовых сертификатов.Ваше выздоровление в любом из этих события могут быть ограничены двумя факторами:

4



в случае дефолта рыночная стоимость лежащих в основе ценных бумаг может быть подвергнута неблагоприятному воздействию, и выручка от их продажи может быть ниже, чем совокупная приведенная стоимость или заявленная сумма. (если применимо) доверительных сертификатов; и
в любом случае любое распределение фондов или лежащих в основе ценных бумаг трастом держателям сертификатов траста будет осуществляться в соответствии с коэффициентом распределения, как описано в применимое приложение к проспекту эмиссии, относящееся к трастовым сертификатам.Денежные средства или совокупная основная сумма базовых ценных бумаг, которые вы получаете в результате этого распределения, могут быть меньше нынешнего стоимость или указанная сумма (если применимо) ваших доверительных сертификатов.

Доверительный управляющий НЕ БУДЕТ УПРАВЛЯТЬ БАЗОВЫМИ ЦЕННЫМИ БУМАГАМИ

За исключением случаев, описанных ниже, траст не будет продавать какие-либо базовые ценные бумаги, даже если произойдет событие, которое отрицательно повлияет на стоимость базовых ценных бумаг или что отрицательно влияет на эмитента лежащих в основе ценных бумаг.Как предусмотрено в применимом трастовом соглашении, траст будет продавать лежащие в основе ценные бумаги, только если:

имеется дефолт по любым базовым ценным бумагам,
существует другой тип дефолта, который ускоряет срок погашения базовых ценных бумаг, или
эмитент соответствующих ценных бумаг прекращает подавать отчеты по Акту о биржах.

При первом перечисленном выше обстоятельстве доверительный управляющий должен продать базовые ценные бумаги от имени траста, даже если существуют неблагоприятные рыночные условия. Доверительный управляющий не имеет право поступить иначе. Если неблагоприятные рыночные условия действительно существуют во время продажи доверительным управляющим базовых ценных бумаг, вы можете понести большие убытки, чем если бы траст продолжал удерживать базовые ценные бумаги.

СЕРТИФИКАТЫ ДОВЕРИЯ ПОДВЕРГАЮТСЯ КРЕДИТНОСТНОЙ ДОСТУПНОСТИ ЭМИТЕНТА ЭМИССИОННЫХ ЦЕННЫХ БУМАГ

Трастовые сертификаты представляют интересы в обязательствах соответствующего эмитента ценных бумаг.В частности, доверительные сертификаты будут подвержены всем связанным с этим рискам. с прямым инвестированием в необеспеченные несубординированные долговые обязательства эмитента соответствующих ценных бумаг. Ни базовое соглашение, ни базовые ценные бумаги не накладывают ограничений на сумма задолженности, которая может понести соответствующий эмитент ценных бумаг.

5



ПЛАТЕЖИ ДОВЕРЕННЫХ СЕРТИФИКАТОВ ЯВЛЯЮТСЯ НЕЗАКРЕПЛЕННЫМИ ОБЯЗАТЕЛЬСТВАМИ

При ликвидации держатели базовых ценных бумаг, включая траст, получат выплаты только после того, как держатели обеспеченных обязательств эмитента базовых ценных бумаг.Согласно Согласно проспекту базовых ценных бумаг, базовые ценные бумаги являются необеспеченными и имеют равный статус со всеми другими необеспеченными и несубординированными долговыми обязательствами соответствующего эмитента ценных бумаг. В базовые ценные бумаги и соответствующее соглашение об эмиссии не ограничивают эмитента базовых ценных бумаг или любую из его дочерних компаний в отношении возникновения дополнительной задолженности.

РЕЙТИНГИ СЕРТИФИКАТОВ ДОВЕРИЯ МОГУТ ИЗМЕНИТЬСЯ

Во время выпуска Moody’s и S&P присвоили доверительным сертификатам рейтинги, эквивалентные рейтингам лежащих в основе ценных бумаг на дату применимого приложение к проспекту эмиссии.

Любая оценка, присвоенная доверительным сертификатам, не является рекомендацией покупать, продавать или держать ценные бумаги. Рейтинги не комментируют рыночную стоимость траста. сертификаты или их пригодность для конкретного инвестора. Мы не можем заверить вас, что первоначальные рейтинги сохранятся в течение определенного периода времени или что рейтинговое агентство не будет пересматривать или отзывать полностью рейтинги, если, по его мнению, обстоятельства (включая, помимо прочего, рейтинг лежащих в основе ценных бумаг) заслуживают внимания.Пересмотр или отмена рейтинга может отрицательно повлиять на рыночная цена доверительных сертификатов.

ПУНКТ 1Б. НЕРЕШЕННЫЕ КОММЕНТАРИИ ПЕРСОНАЛА

Не применимо.

ПУНКТ 2. НЕДВИЖИМОСТЬ

Нет.

ПУНКТ 3. СУДЕБНОЕ РАЗБИРАТЕЛЬСТВО

Нет.

ПУНКТ 4. (УДАЛЕН И ЗАрезервирован)

6



ЧАСТЬ II

ПУНКТ 5. РЫНОК ОБЫЧНЫХ АКЦИЙ РЕГИСТРАТОРА, СВЯЗАННЫХ С АКЦИОНЕРНЫМИ ВОПРОСАМИ И ПОКУПКИ ЭМИТЕНТАМИ АКЦИОНЕРНЫХ ЦЕННЫХ БУМАГ

Доверительные сертификаты, выпущенные PPLUS Trust Series GSG-1, представлены одним или несколькими физическими сертификатами, зарегистрированными на имя Cede & Co., номинант Депозитарная трастовая компания. Сертификаты доверия котируются на Нью-Йоркской фондовой бирже.

ПУНКТ 6. ОТДЕЛЬНЫЕ ФИНАНСОВЫЕ ДАННЫЕ

Не применимо.

ПУНКТ 7. ОБСУЖДЕНИЕ И АНАЛИЗ РУКОВОДСТВА ФИНАНСОВОГО СОСТОЯНИЯ И РЕЗУЛЬТАТОВ ДЕЯТЕЛЬНОСТИ

Не применимо.

ПУНКТ 7А. КОЛИЧЕСТВЕННАЯ И КАЧЕСТВЕННАЯ ИНФОРМАЦИЯ О РЫНОЧНОМ РИСКЕ

Не применимо.

ПУНКТ 8. ФИНАНСОВАЯ ОТЧЕТНОСТЬ И ДОПОЛНИТЕЛЬНЫЕ ДАННЫЕ

Не применимо.

ПУНКТ 9. ИЗМЕНЕНИЯ И РАЗНОГЛАСИЯ С БУХГАЛТЕРАМИ ПО БУХГАЛТЕРСКОМУ УЧЕТУ И РАСКРЫТИЮ ФИНАНСОВОЙ ИНФОРМАЦИИ

Нет.

ПУНКТ 9А. КОНТРОЛЬ И ПРОЦЕДУРЫ

У регистранта есть процедуры, обеспечивающие разумную уверенность в том, что его будущие заявки по Акту о биржах будут поданы в течение соответствующих периодов времени.

ПУНКТ 9Б. ДРУГАЯ ИНФОРМАЦИЯ

Нет.

ЧАСТЬ III

ПУНКТ 10. ДИРЕКТОРЫ, ИСПОЛНИТЕЛЬНЫЕ ЛИЦА И КОРПОРАТИВНОЕ УПРАВЛЕНИЕ

Не применимо.

7



ПУНКТ 11. ИСПОЛНИТЕЛЬНОЕ ВОЗНАГРАЖДЕНИЕ

Не применимо.

ПУНКТ 12. БЕЗОПАСНАЯ СОБСТВЕННОСТЬ ОПРЕДЕЛЕННЫМИ БЕНЕФИЦИАЛЬНЫМИ ВЛАДЕЛЬЦАМИ И УПРАВЛЕНИЕ И СМЕЖНЫЕ ВОПРОСЫ АКЦИОНЕРА

(а) Ценные бумаги, допущенные к выпуску в соответствии с планами компенсации капитала: нет.
б) Безопасность, принадлежащая определенным бенефициарным владельцам: нет.
(в) Безопасность владения менеджментом: не применимо.
(г) Изменения в управлении: нет.

ПУНКТ 13. ОПРЕДЕЛЕННЫЕ ОТНОШЕНИЯ И СВЯЗАННЫЕ СДЕЛКИ И НЕЗАВИСИМОСТЬ ДИРЕКТОРА

Нет.

ПУНКТ 14. ОСНОВНЫЕ БУХГАЛТЕРСКИЕ СБОРЫ И УСЛУГИ

Не применимо.

ЧАСТЬ IV

ПУНКТ 15. ВЫСТАВКИ, ГРАФИК ФИНАНСОВОЙ ОТЧЕТНОСТИ

(a) (1) Финансовая отчетность: не применимо.

(a) (2) Таблицы финансовой отчетности: не применимо.

(а) (3) Список экспонатов

Следующие экспонаты поданы как часть настоящего Годового отчета и включены в него посредством ссылки по форме 10-K:

Сертификат Отчет
31,1. вице-президента регистранта от 22 марта 2010 г. в соответствии с Правилами 13a-14 и 15d-14 Закона о фондовых биржах 1934 г., принятого в соответствии с разделом 302 Закон Сарбейнса-Оксли 2002 года в отношении годового отчета регистранта по форме 10-K за год, закончившийся 31 декабря 2009 года.
99,1. Годовой сертификат соответствия Доверительного управляющего от 9 марта 2010 г.
99,2. PricewaterhouseCoopers LLP, независимой зарегистрированной государственной бухгалтерской фирмы, от 22 марта 2010 г., Заявление регистранта о соблюдении минимальных стандартов обслуживания PPLUS от марта 22, 2010 и Минимальные стандарты обслуживания PPLUS.

8



99,3. Отчет KPMG LLP, независимой зарегистрированной государственной бухгалтерской фирмы, от 9 марта 2010 г., Заявление Банка Нью-Йорка Меллона о соблюдении минимальных стандартов обслуживания PPLUS от 9 марта, 2010 и Минимальные стандарты обслуживания PPLUS.

(б) Экспонаты

Регистрант настоящим подает как часть этого годового отчета по форме 10-K экспонаты, перечисленные в пункте 15 (а) (3), изложенном выше.

(c) Таблицы финансовой отчетности

Не применимо.

9



ПОДПИСИ

В соответствии с требованиями Раздела 13 или 15 (d) Закона о фондовых биржах 1934 г., регистрант должен должным образом обеспечил подписание настоящего отчета от своего имени нижеподписавшимися, должным образом уполномоченными на это настоящим документом.

MERRILL LYNCH DEPOSITOR, INC.
Дата: 22 марта 2010 г. По: Джон Марчиано
Имя: Джон Марчиано
Название: Вице-президент


Блог GSG — GSG-CPA

Опубликовано: 12.03.2021 Автор: GSG

11 марта 2021 года президент Байден подписал Закон об американском плане спасения 2021 года (Закон) и 1 доллар.9 триллионов, которые точно соответствуют рамкам, которые… Читать дальше »

Категории: Налоги, Малый бизнес, Налоговое планирование, Ресурсы по COVID-19 Опубликовано: 12.03.2021 Автор: GSG

Контроллер Питер Франшо объявил в четверг, 11 марта, крайний срок подачи налоговой декларации штата в Мэриленде продлен до 15 июля. Расширение… Читать дальше »

Категории: Налоги, Налоговое планирование, Ресурсы по COVID-19 Опубликовано: 11.03.2021 Автор: GSG

Первоначально санкционированный Конгрессом в 2012 году, демонстрация HUD по оказанию помощи в аренде (RAD) была создана для сбора средств на сохранение государственного жилья, что в конечном итоге позволило жилищным властям… Читать дальше »

Категории: Аудит и бухгалтерский учет, Недвижимость Опубликовано: 09.03.2021 Автор: GSG

В последнем подкасте GSG из серии подкастов FAR, состоящей из трех частей, директор по аудиту и бухгалтерским услугам Джон Махаффи обсуждает отдельные области затрат, которые… Читать дальше »

Категории: Аудит и бухгалтерский учет, Государственные подрядчики Опубликовано: 02.03.2021 Автор: GSG

Во второй части серии подкастов GSG, состоящей из трех частей, Джон Махаффи, директор по аудиту и бухгалтерским услугам, выделяет отдельные области затрат, которые допустимы в рамках… Читать дальше »

Категории: Аудит и бухгалтерский учет, Государственные подрядчики Опубликовано: 23.02.2021 Автор: GSG

Директор по аудиту и бухгалтерскому учету Джон Махаффи начинает первую часть серии подкастов FAR, состоящей из трех частей, с обзора того, как определить… Читать дальше »

Категории: Аудит и бухгалтерский учет, Государственные подрядчики Опубликовано: 21.01.2021 Автор: GSG В последнем подкасте

GSG представлен Алан Сперо, который обсуждает новый раунд займов ГЧП и то, как компании могут им воспользоваться.Еще в марте… Читать дальше »

Категории: Налоги, Малый бизнес, Налоговое планирование, Ресурсы по COVID-19 Опубликовано: 20.01.2021 Автор: GSG

Когда 27 марта 2020 года был подписан закон о CARES, он учредил налоговый кредит на удержание сотрудников (ERTC), который давал правомочным работодателям… Читать дальше »

Категории: Налоги, Налоговое планирование, Ресурсы по COVID-19 Опубликовано: 08.01.2021 Автор: GSG

6 января 2021 года SBA опубликовало руководство по Программе защиты зарплаты (PPP), в котором разъясняются оба займа, полученные в первый раз… Читать дальше »

Категории: Налоги, Ресурсы по COVID-19 Опубликовано: 08.01.2021 Автор: GSG

Контроллер Мэриленда выпустил пресс-релиз и налоговое уведомление 6 января 2021 года, в котором предусматривается продление времени для подачи налоговой декларации и налоговых… Читать дальше »

Категории: Налоги, Налоговое планирование, Ресурсы по COVID-19

Gsg1 MGI Сведения о гене мыши — MGI: 1194499

Модель гена 5-132939222 (-)
Штамм ID Тип элемента Координаты Выберите штаммы
C57BL / 6J MGI_C57BL6J_1194499 ген, кодирующий белок Chr6: 135237326-135254351 (-)
129S1 / SvImJ MGP_129S1SvImJ_G0031417 ген, кодирующий белок Chr6: 139584630-139602780 (-)
A / J MGP_AJ_G0031393 ген, кодирующий белок Chr6: 134067794-134084776 (-)
AKR / J MGP_AKRJ_G0031320 ген, кодирующий белок Chr6: 138150136-138167122 (-)
BALB / cJ MGP_BALBcJ_G0031399 ген, кодирующий белок Chr6: 1335-133923894 (-)
C3H / HeJ MGP_C3HHeJ_G0031121 ген, кодирующий белок Chr6: 138187712-138204728 (-)
C57BL / 6NJ MGP_C57BL6NJ_G0031859 ген, кодирующий белок Chr6: 143379113-143397162 (-)
КАРОЛИ / ЭЙДЖ MGP_CAROLIEiJ_G0028991 ген, кодирующий белок Chr6: 133223230-133240811 (-)
CAST / EiJ MGP_CASTEiJ_G0030490 ген, кодирующий белок Chr6: 137629698-137646798 (-)
CBA / J MGP_CBAJ_G0031080 ген, кодирующий белок Chr6: 148712130-148729101 (-)
DBA / 2J MGP_DBA2J_G0031238 ген, кодирующий белок Chr6: 132
FVB / NJ MGP_FVBNJ_G0031188 ген, кодирующий белок Chr6: 131842420-131859800 (-)
LP / J MGP_LPJ_G0031322 ген, кодирующий белок Chr6: 139662491-139684604 (-)
NOD / ShiLtJ MGP_NODShiLtJ_G0031228 ген, кодирующий белок Chr6: 152727081-152744036 (-)
NZO / HlLtJ MGP_NZOHlLtJ_G0031892 ген, кодирующий белок Chr6: 1378-137928614 (-)
PWK / PhJ MGP_PWKPhJ_G0030215 ген, кодирующий белок Chr6: 131424803-131442588 (-)
SPRET / EiJ MGP_SPRETEiJ_G0030039 ген, кодирующий белок Chr6: 136080325-136098237 (-)
WSB / EiJ MGP_WSBEiJ_G0030581 ген, кодирующий белок Chr6: 138536829-138555686 (-)

GSG ETF Guide | Котировка акций, авуары, информационный бюллетень и многое другое

Авторские права MSCI ESG Research LLC [2018].Все права защищены. Продукты Fund Metrics («Информация») компании MSCI ESG Research LLC («MSCI ESG») предоставляют экологические, социальные и управленческие данные в отношении базовых ценных бумаг в рамках более чем 23 000 паевых инвестиционных фондов и ETF с несколькими классами активов по всему миру. MSCI ESG является зарегистрированным инвестиционным консультантом в соответствии с Законом об инвестиционных консультантах 1940 года. Материалы MSCI ESG не подавались и не получали одобрения от SEC США или любого другого регулирующего органа. Никакая информация не является предложением о покупке или продаже, продвижением или рекомендацией какой-либо ценной бумаги, финансового инструмента, продукта или торговой стратегии и не должна рассматриваться как указание или гарантия каких-либо будущих результатов, анализа, прогноза или прогноза. .Никакая информация не может использоваться для определения того, какие ценные бумаги покупать или продавать, а также когда их покупать или продавать. Информация предоставляется «как есть», и пользователь Информации принимает на себя весь риск любого использования, которое он может сделать или разрешить использовать. Вся информация предоставляется исключительно для вашего внутреннего использования и не может быть воспроизведена или распространена в любой форме без предварительного письменного разрешения MSCI. Ни MSCI ESG, ни его аффилированные лица, ни какие-либо третьи стороны, участвующие или связанные с созданием какой-либо Информации, не дают никаких явных или подразумеваемых гарантий, заявлений или гарантий, и ни в коем случае MSCI ESG, любое такое аффилированное лицо или третье лицо не несут ответственности за какие-либо прямые, косвенные, особые, штрафные, косвенные или любые другие убытки (включая упущенную выгоду), относящиеся к любой Информации.Более подробную информацию о показателях фонда MSCI ESG, предоставленную MSCI ESG Research LLC, можно найти по адресу https://www.msci.com/esg-fund-metrics. © 2021 Рыночные данные предоставлены с задержкой как минимум на 15 минут и размещены Barchart Solutions.

Добавить комментарий

Ваш адрес email не будет опубликован.